Incidental Mutation 'R0622:Itpk1'
ID58744
Institutional Source Beutler Lab
Gene Symbol Itpk1
Ensembl Gene ENSMUSG00000057963
Gene Nameinositol 1,3,4-triphosphate 5/6 kinase
Synonyms
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R0622 (G1)
Quality Score178
Status Not validated
Chromosome12
Chromosomal Location102568582-102704930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102573980 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 281 (D281E)
Ref Sequence ENSEMBL: ENSMUSP00000046027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046518]
Predicted Effect probably damaging
Transcript: ENSMUST00000046518
AA Change: D281E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046027
Gene: ENSMUSG00000057963
AA Change: D281E

DomainStartEndE-ValueType
Pfam:Ins134_P3_kin 1 318 2.8e-142 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mice homozygous for a gene trap allele exhibit neural tube defects (exencephaly and spina bifida), growth retardation, kyphoscoliosis, and rib formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Itpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Itpk1 APN 12 102606103 missense probably damaging 1.00
IGL02247:Itpk1 APN 12 102623409 missense probably damaging 1.00
IGL02998:Itpk1 APN 12 102579139 missense probably damaging 1.00
ANU23:Itpk1 UTSW 12 102606103 missense probably damaging 1.00
R0432:Itpk1 UTSW 12 102606078 splice site probably benign
R0659:Itpk1 UTSW 12 102606078 splice site probably benign
R0835:Itpk1 UTSW 12 102675448 missense probably damaging 1.00
R1171:Itpk1 UTSW 12 102606119 missense probably damaging 1.00
R1812:Itpk1 UTSW 12 102574058 missense probably benign 0.01
R1968:Itpk1 UTSW 12 102675470 splice site probably null
R2277:Itpk1 UTSW 12 102570260 missense probably benign
R2926:Itpk1 UTSW 12 102579130 missense probably damaging 1.00
R4584:Itpk1 UTSW 12 102570157 missense possibly damaging 0.89
R4690:Itpk1 UTSW 12 102606175 missense probably damaging 0.96
R5050:Itpk1 UTSW 12 102704810 missense probably damaging 1.00
R5326:Itpk1 UTSW 12 102573966 missense possibly damaging 0.49
R5801:Itpk1 UTSW 12 102573945 missense probably damaging 1.00
R5945:Itpk1 UTSW 12 102588553 missense probably damaging 0.97
R7262:Itpk1 UTSW 12 102675453 missense possibly damaging 0.89
R7421:Itpk1 UTSW 12 102574065 missense possibly damaging 0.92
X0058:Itpk1 UTSW 12 102574024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCATGGCACTCAGCCTAGATTC -3'
(R):5'- AAGTTCTGACCCCAATGCTGTCTTC -3'

Sequencing Primer
(F):5'- TCAGCCTAGATTCCAGCATGAG -3'
(R):5'- TGATCTCAGACACTCCAGGG -3'
Posted On2013-07-11