Incidental Mutation 'R0622:Rfx2'
ID58759
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Nameregulatory factor X, 2 (influences HLA class II expression)
Synonyms5430432H19Rik
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R0622 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56775897-56831008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56777071 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 657 (D657G)
Ref Sequence ENSEMBL: ENSMUSP00000084010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801] [ENSMUST00000168666]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
AA Change: D682G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: D682G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000086801
AA Change: D657G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: D657G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168666
SMART Domains Protein: ENSMUSP00000127457
Gene: ENSMUSG00000090273

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Pfam:PRR22 58 422 2.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187612
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 56783657 missense probably damaging 1.00
IGL01296:Rfx2 APN 17 56808317 start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 56805398 missense probably damaging 1.00
IGL01705:Rfx2 APN 17 56785303 missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 56808325 splice site probably benign
IGL02601:Rfx2 APN 17 56785354 missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 56805404 missense probably benign 0.00
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0197:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R0370:Rfx2 UTSW 17 56799308 missense probably benign 0.03
R0413:Rfx2 UTSW 17 56784418 splice site probably benign
R0883:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R1429:Rfx2 UTSW 17 56804369 missense probably damaging 0.97
R1439:Rfx2 UTSW 17 56787720 missense probably damaging 1.00
R1569:Rfx2 UTSW 17 56804326 missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 56808263 missense probably benign 0.00
R1751:Rfx2 UTSW 17 56784754 missense probably benign 0.01
R1816:Rfx2 UTSW 17 56808305 nonsense probably null
R2282:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R3408:Rfx2 UTSW 17 56803526 missense probably benign 0.00
R3962:Rfx2 UTSW 17 56785302 missense probably damaging 0.99
R4415:Rfx2 UTSW 17 56787733 missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 56784706 missense probably benign 0.00
R4883:Rfx2 UTSW 17 56783747 missense probably damaging 0.98
R5588:Rfx2 UTSW 17 56779890 missense possibly damaging 0.69
R5766:Rfx2 UTSW 17 56803587 missense probably benign 0.02
R5798:Rfx2 UTSW 17 56804362 missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 56780778 missense probably damaging 0.99
R6061:Rfx2 UTSW 17 56777473 missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 56784397 missense probably benign 0.13
R6800:Rfx2 UTSW 17 56780804 missense probably damaging 0.99
R7329:Rfx2 UTSW 17 56803681 missense probably benign 0.05
R7476:Rfx2 UTSW 17 56803527 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GACCATCTTAGTTGCCCACAGTCTC -3'
(R):5'- TGTCACTGACCCTGCTGGACAAAG -3'

Sequencing Primer
(F):5'- CCTTGGGTCACAGTAAACATGG -3'
(R):5'- CATCCTGTGGTAGCTTAACAGAG -3'
Posted On2013-07-11