Incidental Mutation 'R0624:Cdk18'
ID58766
Institutional Source Beutler Lab
Gene Symbol Cdk18
Ensembl Gene ENSMUSG00000026437
Gene Namecyclin-dependent kinase 18
SynonymsPctk3
MMRRC Submission 038813-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R0624 (G1)
Quality Score144
Status Validated
Chromosome1
Chromosomal Location132112237-132139684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132118872 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 192 (L192P)
Ref Sequence ENSEMBL: ENSMUSP00000027697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027697] [ENSMUST00000112362]
Predicted Effect probably damaging
Transcript: ENSMUST00000027697
AA Change: L192P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027697
Gene: ENSMUSG00000026437
AA Change: L192P

DomainStartEndE-ValueType
S_TKc 121 402 1.13e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112362
AA Change: L192P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107981
Gene: ENSMUSG00000026437
AA Change: L192P

DomainStartEndE-ValueType
S_TKc 121 402 1.13e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189733
Meta Mutation Damage Score 0.44 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 noncoding transcript Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Atp4a A G 7: 30,718,999 N571D probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I noncoding transcript Het
Cc2d2a A T 5: 43,730,029 H1328L probably benign Het
Cdk9 A T 2: 32,709,824 Y185N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Chd8 C T 14: 52,219,757 G918D possibly damaging Het
Csnk1e T A 15: 79,419,898 noncoding transcript Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 noncoding transcript Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I121T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Inadl T C 4: 98,681,235 probably benign Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr372 T A 8: 72,058,162 S161T possibly damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Pclo A G 5: 14,669,656 E1269G unknown Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 noncoding transcript Het
Psap T G 10: 60,299,566 noncoding transcript Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D249G probably null Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sbf1 C T 15: 89,302,329 D898N possibly damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P491T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I326N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tacc2 A G 7: 130,577,509 D9G probably damaging Het
Tapt1 T G 5: 44,177,106 L514F possibly damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G682A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 noncoding transcript Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 noncoding transcript Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Cdk18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cdk18 APN 1 132115488 missense probably benign 0.36
IGL00929:Cdk18 APN 1 132118519 unclassified probably null
R0184:Cdk18 UTSW 1 132118538 missense probably benign 0.00
R0606:Cdk18 UTSW 1 132117617 splice site noncoding transcript
R1295:Cdk18 UTSW 1 132119960 splice site noncoding transcript
R1296:Cdk18 UTSW 1 132119960 splice site noncoding transcript
R1298:Cdk18 UTSW 1 132122451 start gained unknown
R1611:Cdk18 UTSW 1 132122375 missense probably damaging 1.00
R1959:Cdk18 UTSW 1 132117821 missense possibly damaging 0.95
R2184:Cdk18 UTSW 1 132115952 missense probably damaging 1.00
R2279:Cdk18 UTSW 1 132115952 missense probably damaging 1.00
R2391:Cdk18 UTSW 1 132115474 missense probably benign
R4601:Cdk18 UTSW 1 132116919 missense possibly damaging 0.95
R5001:Cdk18 UTSW 1 132118849 critical splice donor site probably null
R5208:Cdk18 UTSW 1 132117480 critical splice donor site probably null
R5818:Cdk18 UTSW 1 132119098 critical splice donor site probably null
R6282:Cdk18 UTSW 1 132120020 missense probably damaging 1.00
R6546:Cdk18 UTSW 1 132122350 missense probably damaging 0.99
R6644:Cdk18 UTSW 1 132122069 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAAGGAAGCCCTGTCCTGTCTG -3'
(R):5'- GCTATTCGAGAGGGTACAATGTCCG -3'

Sequencing Primer
(F):5'- AGTACCCTGGCCCTGAATC -3'
(R):5'- TCAGCAGCCTGCACCTG -3'
Posted OnJul 11, 2013