Incidental Mutation 'R0624:Pclo'
ID58791
Institutional Source Beutler Lab
Gene Symbol Pclo
Ensembl Gene ENSMUSG00000061601
Gene Namepiccolo (presynaptic cytomatrix protein)
SynonymsAcz, Pico
MMRRC Submission 038813-MU
Accession Numbers

Ncbi RefSeq: NM_011995.4; NM_001110796.1; MGI:1349390

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0624 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location14514918-14863459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14669656 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1269 (E1269G)
Ref Sequence ENSEMBL: ENSMUSP00000030691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030691] [ENSMUST00000182407]
Predicted Effect unknown
Transcript: ENSMUST00000030691
AA Change: E1269G
SMART Domains Protein: ENSMUSP00000030691
Gene: ENSMUSG00000061601
AA Change: E1269G

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.23e-13 PROSPERO
internal_repeat_2 305 389 1.23e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 530 589 5.2e-30 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 995 1053 6.7e-33 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_4 1196 1249 1.65e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_4 3473 3521 1.65e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
low complexity region 4870 4892 N/A INTRINSIC
C2 4951 5057 8.56e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182407
AA Change: E1269G
SMART Domains Protein: ENSMUSP00000138419
Gene: ENSMUSG00000061601
AA Change: E1269G

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.06e-13 PROSPERO
internal_repeat_2 305 389 1.06e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 528 589 3e-36 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 993 1053 4.3e-37 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_3 1196 1249 1.46e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_3 3473 3521 1.46e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198643
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype Strain: 3699630; 4442915; 4442914
Lethality: D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the presynaptic cytoskeletal matrix, which is involved in establishing active synaptic zones and in synaptic vesicle trafficking. Variations in this gene have been associated with bipolar disorder and major depressive disorder. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for one deletion of Pclo are viable and fertile, and display no overt abnormal phenotype. Mice homozygous for another knock-out allele exhibit some premature lethality, decreased body size, and abnormal synaptic vesicle number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 probably benign Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Atp4a A G 7: 30,718,999 N571D probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I probably benign Het
Cc2d2a A T 5: 43,730,029 H1328L probably benign Het
Cdk18 A G 1: 132,118,872 L192P probably damaging Het
Cdk9 A T 2: 32,709,824 Y185N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Chd8 C T 14: 52,219,757 G918D possibly damaging Het
Csnk1e T A 15: 79,419,898 probably benign Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 probably benign Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I121T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr372 T A 8: 72,058,162 S161T possibly damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Patj T C 4: 98,681,235 probably benign Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 probably benign Het
Psap T G 10: 60,299,566 probably benign Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D197G probably benign Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sbf1 C T 15: 89,302,329 D898N possibly damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P491T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I326N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tacc2 A G 7: 130,577,509 D9G probably damaging Het
Tapt1 T G 5: 44,177,106 L514F possibly damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G682A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 probably benign Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 probably benign Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Pclo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Pclo APN 5 14521677 nonsense probably null
IGL00429:Pclo APN 5 14680739 missense probably benign
IGL00498:Pclo APN 5 14540739 missense unknown
IGL00528:Pclo APN 5 14676434 missense probably null
IGL00743:Pclo APN 5 14678021 missense probably benign
IGL00809:Pclo APN 5 14675797 missense unknown
IGL00811:Pclo APN 5 14680010 missense probably benign
IGL00819:Pclo APN 5 14858846 missense unknown
IGL00870:Pclo APN 5 14539983 missense unknown
IGL00925:Pclo APN 5 14766741 missense unknown
IGL00960:Pclo APN 5 14675220 missense unknown
IGL01013:Pclo APN 5 14793834 unclassified unknown
IGL01112:Pclo APN 5 14681069 missense unknown
IGL01124:Pclo APN 5 14714329 missense unknown
IGL01150:Pclo APN 5 14676912 missense probably benign
IGL01302:Pclo APN 5 14675999 missense probably benign
IGL01389:Pclo APN 5 14714521 missense probably damaging 0.99
IGL01448:Pclo APN 5 14676394 missense probably benign
IGL01449:Pclo APN 5 14678516 missense probably benign
IGL01450:Pclo APN 5 14677193 missense probably benign
IGL01476:Pclo APN 5 14521108 missense probably damaging 1.00
IGL01537:Pclo APN 5 14539633 missense unknown
IGL01568:Pclo APN 5 14678429 missense probably benign
IGL01574:Pclo APN 5 14713448 missense unknown
IGL01637:Pclo APN 5 14540034 missense unknown
IGL01646:Pclo APN 5 14713867 missense unknown
IGL01672:Pclo APN 5 14678535 missense probably benign
IGL01705:Pclo APN 5 14677865 missense probably benign
IGL02127:Pclo APN 5 14765145 unclassified probably benign
IGL02215:Pclo APN 5 14856985 missense unknown
IGL02271:Pclo APN 5 14679494 missense probably benign
IGL02300:Pclo APN 5 14713741 missense unknown
IGL02346:Pclo APN 5 14677538 missense probably benign
IGL02449:Pclo APN 5 14515343 missense probably damaging 1.00
IGL02452:Pclo APN 5 14676966 missense probably benign
IGL02455:Pclo APN 5 14540175 missense unknown
IGL02478:Pclo APN 5 14766778 missense unknown
IGL02677:Pclo APN 5 14676929 missense probably benign
IGL02711:Pclo APN 5 14522308 missense unknown
IGL02737:Pclo APN 5 14714163 missense unknown
IGL02943:Pclo APN 5 14669221 missense unknown
IGL03184:Pclo APN 5 14714443 missense probably damaging 1.00
IGL03246:Pclo APN 5 14677617 missense probably benign
IGL03263:Pclo APN 5 14681810 missense unknown
IGL03300:Pclo APN 5 14712798 missense unknown
IGL03399:Pclo APN 5 14766731 missense unknown
P0018:Pclo UTSW 5 14677721 missense probably benign
R0014:Pclo UTSW 5 14680451 missense probably benign
R0014:Pclo UTSW 5 14680451 missense probably benign
R0020:Pclo UTSW 5 14669673 missense unknown
R0045:Pclo UTSW 5 14539471 missense unknown
R0046:Pclo UTSW 5 14540479 missense unknown
R0046:Pclo UTSW 5 14540479 missense unknown
R0128:Pclo UTSW 5 14679797 missense probably benign
R0130:Pclo UTSW 5 14679797 missense probably benign
R0141:Pclo UTSW 5 14791922 missense unknown
R0226:Pclo UTSW 5 14765223 missense probably damaging 0.99
R0243:Pclo UTSW 5 14775420 missense unknown
R0267:Pclo UTSW 5 14681180 missense unknown
R0313:Pclo UTSW 5 14678873 missense probably benign
R0324:Pclo UTSW 5 14669433 missense unknown
R0331:Pclo UTSW 5 14680376 missense probably benign
R0370:Pclo UTSW 5 14521090 missense probably damaging 1.00
R0398:Pclo UTSW 5 14681702 missense unknown
R0401:Pclo UTSW 5 14681734 missense unknown
R0417:Pclo UTSW 5 14713022 missense unknown
R0468:Pclo UTSW 5 14677288 missense probably benign
R0472:Pclo UTSW 5 14681594 missense unknown
R0488:Pclo UTSW 5 14669299 missense unknown
R0511:Pclo UTSW 5 14678285 missense probably benign
R0511:Pclo UTSW 5 14679398 missense probably benign
R0520:Pclo UTSW 5 14713830 nonsense probably null
R0547:Pclo UTSW 5 14792072 missense unknown
R0611:Pclo UTSW 5 14678775 missense probably benign
R0611:Pclo UTSW 5 14712814 missense unknown
R0628:Pclo UTSW 5 14669538 missense unknown
R0639:Pclo UTSW 5 14681749 nonsense probably null
R0653:Pclo UTSW 5 14682255 missense probably benign
R0681:Pclo UTSW 5 14675318 missense unknown
R0689:Pclo UTSW 5 14714019 missense unknown
R0698:Pclo UTSW 5 14712516 missense unknown
R0737:Pclo UTSW 5 14515439 missense probably damaging 1.00
R0883:Pclo UTSW 5 14677859 nonsense probably null
R0906:Pclo UTSW 5 14676686 missense probably benign
R1056:Pclo UTSW 5 14540055 nonsense probably null
R1107:Pclo UTSW 5 14677869 missense probably benign
R1174:Pclo UTSW 5 14677646 missense probably benign
R1184:Pclo UTSW 5 14522262 missense unknown
R1302:Pclo UTSW 5 14681633 missense unknown
R1318:Pclo UTSW 5 14679314 missense probably benign
R1342:Pclo UTSW 5 14682177 missense probably benign
R1378:Pclo UTSW 5 14682313 missense probably benign 0.23
R1418:Pclo UTSW 5 14678130 missense probably benign
R1471:Pclo UTSW 5 14680427 missense probably benign
R1485:Pclo UTSW 5 14713779 missense unknown
R1523:Pclo UTSW 5 14788406 missense unknown
R1527:Pclo UTSW 5 14679648 missense probably benign
R1531:Pclo UTSW 5 14521903 missense probably damaging 0.99
R1537:Pclo UTSW 5 14712475 missense unknown
R1574:Pclo UTSW 5 14679831 missense probably benign
R1574:Pclo UTSW 5 14679831 missense probably benign
R1581:Pclo UTSW 5 14521282 missense probably benign 0.28
R1613:Pclo UTSW 5 14679132 missense probably benign
R1632:Pclo UTSW 5 14680003 missense probably benign
R1688:Pclo UTSW 5 14788493 critical splice donor site probably null
R1694:Pclo UTSW 5 14520963 missense probably damaging 1.00
R1707:Pclo UTSW 5 14713224 missense unknown
R1727:Pclo UTSW 5 14676987 missense probably benign
R1741:Pclo UTSW 5 14676510 missense probably benign
R1853:Pclo UTSW 5 14676684 missense probably benign
R1856:Pclo UTSW 5 14778552 missense probably damaging 1.00
R1907:Pclo UTSW 5 14678511 missense probably benign
R1970:Pclo UTSW 5 14713473 missense unknown
R1971:Pclo UTSW 5 14713473 missense unknown
R1973:Pclo UTSW 5 14676059 unclassified probably null
R1978:Pclo UTSW 5 14713795 missense unknown
R1999:Pclo UTSW 5 14677080 missense probably benign
R2015:Pclo UTSW 5 14521501 missense probably damaging 0.98
R2084:Pclo UTSW 5 14682148 missense probably benign 0.23
R2144:Pclo UTSW 5 14858752 missense unknown
R2155:Pclo UTSW 5 14714295 missense probably benign 0.02
R2191:Pclo UTSW 5 14713848 missense unknown
R2237:Pclo UTSW 5 14713938 missense unknown
R2276:Pclo UTSW 5 14714273 missense unknown
R2279:Pclo UTSW 5 14714273 missense unknown
R2281:Pclo UTSW 5 14540332 missense unknown
R2307:Pclo UTSW 5 14678651 missense probably benign
R2386:Pclo UTSW 5 14765247 missense unknown
R2407:Pclo UTSW 5 14678932 missense probably null
R2512:Pclo UTSW 5 14712598 missense unknown
R2889:Pclo UTSW 5 14856981 missense unknown
R2966:Pclo UTSW 5 14681150 missense unknown
R3151:Pclo UTSW 5 14521678 missense probably damaging 0.99
R3424:Pclo UTSW 5 14680418 missense probably benign
R3687:Pclo UTSW 5 14668995 missense unknown
R3719:Pclo UTSW 5 14521161 missense probably benign 0.33
R3739:Pclo UTSW 5 14680899 missense unknown
R3745:Pclo UTSW 5 14678421 missense probably benign
R3771:Pclo UTSW 5 14539408 critical splice acceptor site probably null
R3789:Pclo UTSW 5 14680450 missense probably benign
R3803:Pclo UTSW 5 14515402 nonsense probably null
R3902:Pclo UTSW 5 14712522 missense probably benign 0.01
R3942:Pclo UTSW 5 14679918 missense probably benign
R4061:Pclo UTSW 5 14540566 missense unknown
R4094:Pclo UTSW 5 14855645 missense unknown
R4175:Pclo UTSW 5 14713875 missense probably damaging 0.99
R4195:Pclo UTSW 5 14677563 missense probably benign
R4398:Pclo UTSW 5 14775366 missense probably damaging 1.00
R4429:Pclo UTSW 5 14678100 missense probably benign
R4523:Pclo UTSW 5 14679992 missense probably benign
R4531:Pclo UTSW 5 14775408 missense unknown
R4552:Pclo UTSW 5 14669271 missense unknown
R4563:Pclo UTSW 5 14521369 missense probably damaging 1.00
R4581:Pclo UTSW 5 14675505 missense unknown
R4638:Pclo UTSW 5 14680433 nonsense probably null
R4655:Pclo UTSW 5 14682383 missense probably benign
R4703:Pclo UTSW 5 14676480 missense probably benign
R4704:Pclo UTSW 5 14676480 missense probably benign
R4705:Pclo UTSW 5 14676480 missense probably benign
R4706:Pclo UTSW 5 14714207 missense unknown
R4709:Pclo UTSW 5 14778558 missense unknown
R4755:Pclo UTSW 5 14714348 missense unknown
R4786:Pclo UTSW 5 14723267 missense unknown
R4801:Pclo UTSW 5 14675815 missense unknown
R4802:Pclo UTSW 5 14675815 missense unknown
R4812:Pclo UTSW 5 14540025 missense unknown
R4817:Pclo UTSW 5 14675031 missense unknown
R4817:Pclo UTSW 5 14713125 missense unknown
R4845:Pclo UTSW 5 14679118 missense probably benign
R4876:Pclo UTSW 5 14811680 missense unknown
R4907:Pclo UTSW 5 14680051 intron probably benign
R4943:Pclo UTSW 5 14712637 missense unknown
R4963:Pclo UTSW 5 14669221 missense unknown
R4970:Pclo UTSW 5 14677882 missense probably benign
R4978:Pclo UTSW 5 14714478 missense probably benign 0.23
R4982:Pclo UTSW 5 14679294 missense probably benign
R5019:Pclo UTSW 5 14714367 missense unknown
R5068:Pclo UTSW 5 14679073 missense probably benign
R5092:Pclo UTSW 5 14677308 missense probably benign
R5112:Pclo UTSW 5 14677882 missense probably benign
R5124:Pclo UTSW 5 14677392 missense probably benign
R5210:Pclo UTSW 5 14713450 missense probably damaging 0.99
R5227:Pclo UTSW 5 14713560 missense probably benign 0.23
R5264:Pclo UTSW 5 14676923 missense probably benign
R5280:Pclo UTSW 5 14540717 missense unknown
R5286:Pclo UTSW 5 14679747 missense probably benign
R5297:Pclo UTSW 5 14676249 missense probably benign
R5344:Pclo UTSW 5 14676612 missense probably benign
R5354:Pclo UTSW 5 14678808 missense probably benign
R5358:Pclo UTSW 5 14712736 nonsense probably null
R5363:Pclo UTSW 5 14669410 missense unknown
R5377:Pclo UTSW 5 14681353 missense unknown
R5457:Pclo UTSW 5 14676143 missense probably benign
R5468:Pclo UTSW 5 14680952 missense unknown
R5588:Pclo UTSW 5 14788398 missense unknown
R5836:Pclo UTSW 5 14678535 missense probably benign
R5865:Pclo UTSW 5 14714478 missense probably benign 0.23
R5875:Pclo UTSW 5 14680600 missense probably benign
R5892:Pclo UTSW 5 14521171 missense probably damaging 1.00
R5905:Pclo UTSW 5 14680385 missense probably benign
R5967:Pclo UTSW 5 14540655 missense unknown
R6046:Pclo UTSW 5 14713288 missense unknown
R6059:Pclo UTSW 5 14811700 missense unknown
R6092:Pclo UTSW 5 14677923 missense probably benign
R6119:Pclo UTSW 5 14677019 missense probably benign
R6221:Pclo UTSW 5 14675313 missense unknown
R6243:Pclo UTSW 5 14676443 unclassified probably benign
R6269:Pclo UTSW 5 14522094 nonsense probably null
R6303:Pclo UTSW 5 14677893 missense probably benign
R6304:Pclo UTSW 5 14677893 missense probably benign
R6453:Pclo UTSW 5 14676789 missense probably benign
R6460:Pclo UTSW 5 14679132 missense probably benign
R6497:Pclo UTSW 5 14793855 missense unknown
R6498:Pclo UTSW 5 14669491 missense unknown
R6524:Pclo UTSW 5 14718869 missense unknown
R6682:Pclo UTSW 5 14539879 missense unknown
R6830:Pclo UTSW 5 14681099 missense unknown
X0058:Pclo UTSW 5 14682131 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAAAGTGGCTTCACTGGCTTGTG -3'
(R):5'- TTTGTGCTGTCCAAAGCTTAGAAGTCT -3'

Sequencing Primer
(F):5'- TCACTGGCTTGTGAAGGAGAG -3'
(R):5'- CCTTGCAACTTATAAAGTCAAATAGC -3'
Posted OnJul 11, 2013