Incidental Mutation 'R0624:Tapt1'
ID58796
Institutional Source Beutler Lab
Gene Symbol Tapt1
Ensembl Gene ENSMUSG00000046985
Gene Nametransmembrane anterior posterior transformation 1
Synonyms
MMRRC Submission 038813-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R0624 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location44175154-44226626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44177106 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 514 (L514F)
Ref Sequence ENSEMBL: ENSMUSP00000062110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055128] [ENSMUST00000199374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055128
AA Change: L514F

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062110
Gene: ENSMUSG00000046985
AA Change: L514F

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
Pfam:DUF747 152 456 8.9e-112 PFAM
low complexity region 473 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198388
Predicted Effect probably benign
Transcript: ENSMUST00000199374
SMART Domains Protein: ENSMUSP00000143625
Gene: ENSMUSG00000046985

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein that localizes to the centrosome and/or ciliary basal body. Mutations in this gene disrupt Golgi morphology and trafficking and normal primary cilium formation and these mutations are congenitally manifested by severe undermineralization of the intra-uterine skeleton. A mutation in the mouse ortholog of this gene results in homeotic, posterior-to-anterior transformations of the axial skeleton which are similar to the phenotype of mouse homeobox C8 gene mutants. In mouse, this gene is thought to function downstream of homeobox C8 to transduce extracellular patterning information during axial skeleton development. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for an ENU mutation causing a truncation exhibit vertebral trasnformations and defects in rib attachment and the xiphoid process. Mice homozygous for a transgenic gene disruption exhibit cleft palate and possible anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 probably benign Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Atp4a A G 7: 30,718,999 N571D probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I probably benign Het
Cc2d2a A T 5: 43,730,029 H1328L probably benign Het
Cdk18 A G 1: 132,118,872 L192P probably damaging Het
Cdk9 A T 2: 32,709,824 Y185N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Chd8 C T 14: 52,219,757 G918D possibly damaging Het
Csnk1e T A 15: 79,419,898 probably benign Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 probably benign Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I121T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr372 T A 8: 72,058,162 S161T possibly damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Patj T C 4: 98,681,235 probably benign Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Pclo A G 5: 14,669,656 E1269G unknown Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 probably benign Het
Psap T G 10: 60,299,566 probably benign Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D197G probably benign Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sbf1 C T 15: 89,302,329 D898N possibly damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P491T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I326N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tacc2 A G 7: 130,577,509 D9G probably damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G682A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 probably benign Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 probably benign Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Tapt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Tapt1 APN 5 44178990 missense probably damaging 1.00
IGL03011:Tapt1 APN 5 44193187 unclassified possibly damaging 0.58
IGL03018:Tapt1 APN 5 44204324 missense probably damaging 1.00
R0385:Tapt1 UTSW 5 44218101 splice site probably null
R1491:Tapt1 UTSW 5 44218102 critical splice donor site probably null
R2423:Tapt1 UTSW 5 44192453 missense probably benign 0.08
R4175:Tapt1 UTSW 5 44177105 missense probably benign 0.02
R5794:Tapt1 UTSW 5 44177134 missense probably benign 0.00
X0062:Tapt1 UTSW 5 44194357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAAACTCAGTCAATCCGGTTCC -3'
(R):5'- GAGGCAGGCTCTTTCCAGAATCAG -3'

Sequencing Primer
(F):5'- GTTCCCGCAAATTGTGAACC -3'
(R):5'- GGATAAACAGTGTGTGACTAGCTTC -3'
Posted OnJul 11, 2013