Incidental Mutation 'R0624:Tacc2'
ID58813
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 038813-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0624 (G1)
Quality Score133
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130577509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 9 (D9G)
Ref Sequence ENSEMBL: ENSMUSP00000146419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059145
AA Change: D9G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: D9G

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084513
AA Change: D9G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: D9G

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159694
SMART Domains Protein: ENSMUSP00000124471
Gene: ENSMUSG00000040331

DomainStartEndE-ValueType
Pfam:Nse4-Nse3_bdg 36 94 2.2e-20 PFAM
Pfam:Nse4_C 187 263 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207789
AA Change: D9G

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000207918
AA Change: D9G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000208722
AA Change: D9G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215492
AA Change: D9G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 probably benign Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Atp4a A G 7: 30,718,999 N571D probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I probably benign Het
Cc2d2a A T 5: 43,730,029 H1267L probably benign Het
Cdk18 A G 1: 132,118,872 L192P probably damaging Het
Cdk9 A T 2: 32,709,824 Y134N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Chd8 C T 14: 52,219,757 G918D possibly damaging Het
Csnk1e T A 15: 79,419,898 probably benign Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 probably benign Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I108T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr372 T A 8: 72,058,162 S161T possibly damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Patj T C 4: 98,681,235 probably benign Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Pclo A G 5: 14,669,656 E1269G unknown Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 probably benign Het
Psap T G 10: 60,299,566 probably benign Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D37G probably benign Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sbf1 C T 15: 89,302,329 D898N possibly damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P449T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I154N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tapt1 T G 5: 44,177,106 L514F possibly damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G637A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 probably benign Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 probably benign Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACCAGCCCGTATTGGGAAAG -3'
(R):5'- GCCCCACAGGTACAAGTATGTCAC -3'

Sequencing Primer
(F):5'- GAAGAGATAAACATTCGCTGTCTGC -3'
(R):5'- GGTACAAGTATGTCACATGGGTC -3'
Posted On2013-07-11