Incidental Mutation 'R0624:Olfr372'
ID58818
Institutional Source Beutler Lab
Gene Symbol Olfr372
Ensembl Gene ENSMUSG00000069998
Gene Nameolfactory receptor 372
SynonymsGA_x6K02T2NUPS-191522-192466, MOR282-1
MMRRC Submission 038813-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0624 (G1)
Quality Score168
Status Validated
Chromosome8
Chromosomal Location72057660-72058675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72058162 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 161 (S161T)
Ref Sequence ENSEMBL: ENSMUSP00000132724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093434] [ENSMUST00000215324]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093434
AA Change: S161T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132724
Gene: ENSMUSG00000069998
AA Change: S161T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 221 1.1e-7 PFAM
Pfam:7tm_1 41 290 6.4e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215324
AA Change: S161T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 noncoding transcript Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Atp4a A G 7: 30,718,999 N571D probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I noncoding transcript Het
Cc2d2a A T 5: 43,730,029 H1328L probably benign Het
Cdk18 A G 1: 132,118,872 L192P probably damaging Het
Cdk9 A T 2: 32,709,824 Y185N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Chd8 C T 14: 52,219,757 G918D possibly damaging Het
Csnk1e T A 15: 79,419,898 noncoding transcript Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 noncoding transcript Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I121T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Inadl T C 4: 98,681,235 probably benign Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Pclo A G 5: 14,669,656 E1269G unknown Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 noncoding transcript Het
Psap T G 10: 60,299,566 noncoding transcript Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D249G probably null Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sbf1 C T 15: 89,302,329 D898N possibly damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P491T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I326N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tacc2 A G 7: 130,577,509 D9G probably damaging Het
Tapt1 T G 5: 44,177,106 L514F possibly damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G682A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 noncoding transcript Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 noncoding transcript Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Olfr372
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03251:Olfr372 APN 8 72058076 missense probably damaging 1.00
R0126:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0128:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0130:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0132:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0152:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0230:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0244:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0256:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0257:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0294:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0316:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0318:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0391:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0479:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0604:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0631:Olfr372 UTSW 8 72058322 missense probably damaging 0.99
R1785:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R1786:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R2040:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
R4176:Olfr372 UTSW 8 72058184 missense probably damaging 1.00
R4782:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R4799:Olfr372 UTSW 8 72058094 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATCATTGGCCTGCTAGGCAAC -3'
(R):5'- CATGTGCAGTACAGCTCCCAGAAC -3'

Sequencing Primer
(F):5'- TGATTGCCACAGACTCCAGG -3'
(R):5'- AGCTCCCAGAACGTGGC -3'
Posted OnJul 11, 2013