Incidental Mutation 'R0624:Sbf1'
ID58842
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene NameSET binding factor 1
SynonymsB230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 038813-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R0624 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89288236-89315311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89302329 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 898 (D898N)
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000144585]
PDB Structure
Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000123791
AA Change: D898N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: D898N

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144585
AA Change: D898N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: D898N

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184827
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 noncoding transcript Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Atp4a A G 7: 30,718,999 N571D probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I noncoding transcript Het
Cc2d2a A T 5: 43,730,029 H1328L probably benign Het
Cdk18 A G 1: 132,118,872 L192P probably damaging Het
Cdk9 A T 2: 32,709,824 Y185N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Chd8 C T 14: 52,219,757 G918D possibly damaging Het
Csnk1e T A 15: 79,419,898 noncoding transcript Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 noncoding transcript Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I121T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Inadl T C 4: 98,681,235 probably benign Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr372 T A 8: 72,058,162 S161T possibly damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Pclo A G 5: 14,669,656 E1269G unknown Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 noncoding transcript Het
Psap T G 10: 60,299,566 noncoding transcript Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D249G probably null Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P491T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I326N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tacc2 A G 7: 130,577,509 D9G probably damaging Het
Tapt1 T G 5: 44,177,106 L514F possibly damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G682A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 noncoding transcript Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 noncoding transcript Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89305575 missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89299743 missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89288716 missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89303278 missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89303215 unclassified noncoding transcript
IGL01908:Sbf1 APN 15 89302726 unclassified probably damaging 1.00
IGL02067:Sbf1 APN 15 89289044 missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89302505 nonsense probably null
IGL02150:Sbf1 APN 15 89295480 missense probably benign 0.00
IGL02284:Sbf1 APN 15 89305078 missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89307572 missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89305985 unclassified noncoding transcript
IGL03025:Sbf1 APN 15 89289645 missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89293947 unclassified probably damaging 1.00
IGL03226:Sbf1 APN 15 89289105 missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89289016 unclassified noncoding transcript
IGL03397:Sbf1 APN 15 89288721 missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89295561 missense probably benign 0.26
R0139:Sbf1 UTSW 15 89302498 missense probably damaging 1.00
R0528:Sbf1 UTSW 15 89288712 missense probably damaging 0.99
R0759:Sbf1 UTSW 15 89304716 missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89305076 missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89294425 missense probably null
R2025:Sbf1 UTSW 15 89302730 missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89306693 missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R2845:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R3788:Sbf1 UTSW 15 89299528 nonsense probably null
R4108:Sbf1 UTSW 15 89288585 utr 3 prime noncoding transcript
R4403:Sbf1 UTSW 15 89293954 missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89303481 missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89306926 missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89295246 missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89303112 nonsense probably null
R4697:Sbf1 UTSW 15 89315085 missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89302713 missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89288634 missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89308068 missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89305611 missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89293476 missense probably benign 0.29
R6256:Sbf1 UTSW 15 89300867 missense probably benign 0.06
R6490:Sbf1 UTSW 15 89304908 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACATGAGCCCATCTCCCATTAGG -3'
(R):5'- TTGTCCAGATGCACATTGAGACCC -3'

Sequencing Primer
(F):5'- TATCTCCTGCAAAGAGCTGG -3'
(R):5'- TGCACATTGAGACCCTGGAG -3'
Posted OnJul 11, 2013