Mutagenetix > Incidental Mutation

Incidental Mutation 'R0624:Smad2'

58851

Institutional Source

Beutler Lab

Gene Symbol

Smad2

Ensembl Gene

ENSMUSG00000024563

Gene Name

SMAD family member 2

Synonyms

Madr2, Madh2, Smad 2, 7120426M23Rik

MMRRC Submission

038813-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0624 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76374651-76444034 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76433064 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 332 (I332T)

Ref Sequence

ENSEMBL: ENSMUSP00000130115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]

AlphaFold

Q62432

Predicted Effect

probably damaging
Transcript: ENSMUST00000025453
AA Change: I332T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: I332T

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091831
AA Change: I302T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: I302T

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	1e-10	BLAST
DWB	242	413	2.25e-108	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113930
AA Change: I302T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: I302T

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	9e-11	BLAST
DWB	242	408	4.38e-88	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165084

SMART Domains

Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
DWA	36	144	7.85e-67	SMART
PDB:1KHX\|A	166	204	3e-19	PDB
SCOP:d1khxa_	190	204	7e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168423
AA Change: I332T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: I332T

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171256

SMART Domains

Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWA	182	213	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172198

SMART Domains

Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
Pfam:MH2	28	58	1.8e-10	PFAM

Meta Mutation Damage Score

0.9662

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.2%

Validation Efficiency

98% (88/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	A	11: 110,030,446 (GRCm39)	D767V	probably damaging	Het
Add1	T	A	5: 34,763,197 (GRCm39)	N128K	probably damaging	Het
Ado	A	T	10: 67,384,058 (GRCm39)	D182E	probably benign	Het
Anapc4	T	A	5: 53,002,761 (GRCm39)		probably benign	Het
Ano10	A	G	9: 122,088,661 (GRCm39)		probably benign	Het
Apba2	A	G	7: 64,364,263 (GRCm39)		probably null	Het
Apc2	A	G	10: 80,150,417 (GRCm39)	T1795A	probably benign	Het
Atp4a	A	G	7: 30,418,424 (GRCm39)	N571D	probably benign	Het
Birc6	A	G	17: 74,887,344 (GRCm39)	N891D	probably benign	Het
Bltp2	G	A	11: 78,159,283 (GRCm39)	E494K	probably damaging	Het
Car3	G	T	3: 14,931,864 (GRCm39)	M78I	probably benign	Het
Cc2d2a	A	T	5: 43,887,371 (GRCm39)	H1267L	probably benign	Het
Cdk18	A	G	1: 132,046,610 (GRCm39)	L192P	probably damaging	Het
Cdk9	A	T	2: 32,599,836 (GRCm39)	Y134N	probably damaging	Het
Ceacam5	A	T	7: 17,448,888 (GRCm39)	T85S	probably benign	Het
Cenpe	A	G	3: 134,952,347 (GRCm39)	T1403A	probably benign	Het
Chd8	C	T	14: 52,457,214 (GRCm39)	G918D	possibly damaging	Het
Csnk1e	T	A	15: 79,304,098 (GRCm39)		probably benign	Het
Dctpp1	A	T	7: 126,856,365 (GRCm39)	I119N	probably damaging	Het
Defb34	T	A	8: 19,173,784 (GRCm39)	F6Y	unknown	Het
Dnai4	T	C	4: 102,930,054 (GRCm39)		probably benign	Het
Dvl1	C	G	4: 155,939,232 (GRCm39)	N248K	probably damaging	Het
Dync1h1	T	C	12: 110,618,181 (GRCm39)		probably benign	Het
Dync2i1	T	C	12: 116,211,910 (GRCm39)	D199G	probably damaging	Het
Eml5	T	A	12: 98,831,738 (GRCm39)	R407W	probably damaging	Het
Epb41l5	T	C	1: 119,551,688 (GRCm39)	D99G	probably damaging	Het
Fat1	A	T	8: 45,504,205 (GRCm39)	N4566I	possibly damaging	Het
Gm21834	T	C	17: 58,049,015 (GRCm39)	E67G	possibly damaging	Het
Gsap	T	A	5: 21,458,949 (GRCm39)		probably null	Het
Guf1	T	C	5: 69,715,923 (GRCm39)	I108T	probably damaging	Het
Hsd3b5	T	C	3: 98,526,720 (GRCm39)	D242G	probably damaging	Het
Kcna7	A	G	7: 45,059,114 (GRCm39)	D467G	probably null	Het
Lars1	A	G	18: 42,375,849 (GRCm39)		probably benign	Het
Lrrc56	A	T	7: 140,786,366 (GRCm39)	D248V	probably damaging	Het
Map3k14	T	A	11: 103,133,117 (GRCm39)	E27V	possibly damaging	Het
Med12l	G	A	3: 58,945,123 (GRCm39)	W116*	probably null	Het
Mgll	A	G	6: 88,702,799 (GRCm39)	R33G	probably damaging	Het
Mmp13	A	G	9: 7,280,221 (GRCm39)	S384G	possibly damaging	Het
Nalcn	C	T	14: 123,607,444 (GRCm39)	C675Y	probably benign	Het
Nrxn1	A	G	17: 91,396,117 (GRCm39)	L13P	unknown	Het
Ocstamp	A	G	2: 165,239,772 (GRCm39)	V138A	probably damaging	Het
Or12e8	T	G	2: 87,188,026 (GRCm39)	Y79*	probably null	Het
Or2z8	T	A	8: 72,812,006 (GRCm39)	S161T	possibly damaging	Het
Or4a68	A	G	2: 89,270,482 (GRCm39)	V47A	possibly damaging	Het
Or4f7	T	C	2: 111,645,056 (GRCm39)	N5S	probably damaging	Het
Or5p51	A	G	7: 107,444,323 (GRCm39)	S206P	possibly damaging	Het
Or9i1b	T	G	19: 13,896,808 (GRCm39)	C141W	probably damaging	Het
Patj	T	C	4: 98,569,472 (GRCm39)		probably benign	Het
Pcdhb22	A	G	18: 37,651,780 (GRCm39)	I83V	probably benign	Het
Pclo	A	G	5: 14,719,670 (GRCm39)	E1269G	unknown	Het
Plagl2	T	C	2: 153,077,973 (GRCm39)	T3A	probably benign	Het
Plcb1	C	T	2: 135,136,831 (GRCm39)	P309S	possibly damaging	Het
Pld3	A	T	7: 27,239,000 (GRCm39)	L175Q	possibly damaging	Het
Prrx1	A	G	1: 163,075,974 (GRCm39)		probably benign	Het
Psap	T	G	10: 60,135,345 (GRCm39)		probably benign	Het
Ptgfr	G	A	3: 151,540,839 (GRCm39)	T223M	probably damaging	Het
Reep2	A	T	18: 34,973,824 (GRCm39)	I6F	probably benign	Het
Rraga	A	G	4: 86,494,454 (GRCm39)	E100G	probably benign	Het
Rrm2b	T	C	15: 37,931,889 (GRCm39)	D37G	probably benign	Het
Rtl1	T	C	12: 109,559,153 (GRCm39)	I895M	probably damaging	Het
Ryr1	G	A	7: 28,774,034 (GRCm39)	A2445V	probably damaging	Het
Sbf1	C	T	15: 89,186,532 (GRCm39)	D898N	possibly damaging	Het
Sh3d19	G	A	3: 86,022,213 (GRCm39)	V548I	possibly damaging	Het
Shf	C	A	2: 122,199,116 (GRCm39)		probably benign	Het
Sipa1l3	T	C	7: 29,086,676 (GRCm39)	E638G	probably damaging	Het
Slc13a3	G	T	2: 165,253,807 (GRCm39)	P449T	probably damaging	Het
Slc2a13	C	T	15: 91,234,215 (GRCm39)	V374I	possibly damaging	Het
Slc4a7	T	C	14: 14,794,059 (GRCm38)		probably null	Het
Slc7a2	T	A	8: 41,361,568 (GRCm39)	S414T	probably benign	Het
Slc9c1	A	G	16: 45,393,719 (GRCm39)	E554G	probably benign	Het
Snrnp40	C	T	4: 130,256,451 (GRCm39)	P59S	probably damaging	Het
Sorcs2	A	T	5: 36,222,777 (GRCm39)	I154N	probably damaging	Het
Sort1	G	A	3: 108,255,946 (GRCm39)	G631S	probably damaging	Het
Sox10	T	C	15: 79,043,586 (GRCm39)	D149G	possibly damaging	Het
Spn	C	T	7: 126,735,380 (GRCm39)	V376M	possibly damaging	Het
Tacc2	A	G	7: 130,179,239 (GRCm39)	D9G	probably damaging	Het
Tapt1	T	G	5: 44,334,448 (GRCm39)	L514F	possibly damaging	Het
Tcf3	A	G	10: 80,249,168 (GRCm39)	L480P	probably damaging	Het
Tenm4	G	C	7: 96,423,227 (GRCm39)	G637A	probably damaging	Het
Tex14	T	A	11: 87,411,525 (GRCm39)	N950K	probably benign	Het
Tgfbrap1	T	G	1: 43,098,289 (GRCm39)	H497P	probably benign	Het
Tnfrsf18	A	T	4: 156,110,986 (GRCm39)	Y48F	possibly damaging	Het
Tnxb	A	C	17: 34,902,522 (GRCm39)	H1002P	probably damaging	Het
Ttn	A	G	2: 76,593,571 (GRCm39)		probably benign	Het
Ugt2b34	C	G	5: 87,041,591 (GRCm39)		probably null	Het
Vldlr	A	G	19: 27,215,663 (GRCm39)	D220G	possibly damaging	Het
Vmn1r33	A	T	6: 66,589,121 (GRCm39)	Y144*	probably null	Het
Xrcc4	T	C	13: 90,140,594 (GRCm39)	E205G	possibly damaging	Het

Other mutations in Smad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Smad2	APN	18	76,431,566 (GRCm39)	missense	possibly damaging	0.94
IGL00978:Smad2	APN	18	76,432,846 (GRCm39)	splice site	probably benign
IGL01295:Smad2	APN	18	76,435,501 (GRCm39)	missense	probably benign	0.05
IGL01887:Smad2	APN	18	76,432,965 (GRCm39)	missense	probably damaging	1.00
IGL01960:Smad2	APN	18	76,395,555 (GRCm39)	intron	probably benign
IGL02881:Smad2	APN	18	76,432,851 (GRCm39)	splice site	probably null
IGL02977:Smad2	APN	18	76,422,235 (GRCm39)	missense	possibly damaging	0.64
R0333:Smad2	UTSW	18	76,395,692 (GRCm39)	missense	probably damaging	1.00
R0391:Smad2	UTSW	18	76,422,108 (GRCm39)	critical splice acceptor site	probably null
R0523:Smad2	UTSW	18	76,395,623 (GRCm39)	missense	probably benign
R0570:Smad2	UTSW	18	76,422,250 (GRCm39)	splice site	probably benign
R1573:Smad2	UTSW	18	76,395,657 (GRCm39)	missense	possibly damaging	0.89
R1953:Smad2	UTSW	18	76,395,776 (GRCm39)	missense	possibly damaging	0.90
R2132:Smad2	UTSW	18	76,421,155 (GRCm39)	nonsense	probably null
R2213:Smad2	UTSW	18	76,437,697 (GRCm39)	missense	probably damaging	1.00
R3021:Smad2	UTSW	18	76,395,703 (GRCm39)	missense	probably damaging	1.00
R3917:Smad2	UTSW	18	76,421,008 (GRCm39)	missense	probably benign	0.42
R4503:Smad2	UTSW	18	76,435,663 (GRCm39)	missense	probably benign	0.23
R5253:Smad2	UTSW	18	76,421,124 (GRCm39)	missense	probably damaging	1.00
R5290:Smad2	UTSW	18	76,395,795 (GRCm39)	missense	probably damaging	1.00
R5891:Smad2	UTSW	18	76,433,046 (GRCm39)	missense	probably damaging	1.00
R6294:Smad2	UTSW	18	76,422,233 (GRCm39)	missense	probably benign	0.31
R6879:Smad2	UTSW	18	76,395,725 (GRCm39)	missense	possibly damaging	0.49
R7430:Smad2	UTSW	18	76,421,151 (GRCm39)	missense	probably damaging	1.00
R7503:Smad2	UTSW	18	76,419,956 (GRCm39)	missense	probably benign
R7757:Smad2	UTSW	18	76,421,084 (GRCm39)	missense	probably benign	0.40
R8072:Smad2	UTSW	18	76,420,022 (GRCm39)	critical splice donor site	probably null
R9132:Smad2	UTSW	18	76,395,573 (GRCm39)	missense	possibly damaging	0.87
R9159:Smad2	UTSW	18	76,395,573 (GRCm39)	missense	possibly damaging	0.87
R9184:Smad2	UTSW	18	76,422,171 (GRCm39)	missense	probably benign	0.00
Z1177:Smad2	UTSW	18	76,421,074 (GRCm39)	missense	probably damaging	1.00
Z1177:Smad2	UTSW	18	76,421,073 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCCAGTTACTTACTCGGAACC -3'
(R):5'- TGCCTGCATTCTACATTGAAGCCTC -3'

Sequencing Primer
(F):5'- CGGAACCTGCATTCTGGTG -3'
(R):5'- CATATATAACATCACTGGGAGAAGC -3'

Posted On

2013-07-11