Incidental Mutation 'R0233:Olfr1404'
ID58862
Institutional Source Beutler Lab
Gene Symbol Olfr1404
Ensembl Gene ENSMUSG00000049456
Gene Nameolfactory receptor 1404
SynonymsGA_x6K02T2R7CC-630397-629456, MOR267-2
MMRRC Submission 038474-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0233 (G1)
Quality Score219
Status Validated
Chromosome1
Chromosomal Location173212392-173218583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173216301 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 217 (I217F)
Ref Sequence ENSEMBL: ENSMUSP00000151077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049706] [ENSMUST00000056592] [ENSMUST00000216556] [ENSMUST00000217374]
Predicted Effect probably benign
Transcript: ENSMUST00000049706
SMART Domains Protein: ENSMUSP00000056882
Gene: ENSMUSG00000005339

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 108 1.08e-8 SMART
IG 116 193 1.37e-1 SMART
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056592
AA Change: I217F

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050406
Gene: ENSMUSG00000049456
AA Change: I217F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.9e-55 PFAM
Pfam:7tm_1 42 291 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216556
AA Change: I217F

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217374
AA Change: I217F

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,373 S212P probably benign Het
4932438A13Rik T A 3: 36,948,563 C1552* probably null Het
A730018C14Rik A C 12: 112,415,430 noncoding transcript Het
Acsf3 A G 8: 122,780,292 Y108C probably damaging Het
Acsl1 A G 8: 46,513,569 probably benign Het
Adad1 T A 3: 37,084,948 I389N possibly damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Ano5 T C 7: 51,535,470 F46S possibly damaging Het
Ap2a1 T C 7: 44,915,973 N114S probably damaging Het
Arap1 C T 7: 101,400,241 S970L possibly damaging Het
Atad3a A T 4: 155,746,067 S525T probably damaging Het
B4galnt1 T C 10: 127,170,911 probably benign Het
Cacna2d2 A T 9: 107,514,670 I463F probably damaging Het
Casp6 T A 3: 129,905,975 N34K probably damaging Het
Ccdc175 A T 12: 72,105,876 F752I probably benign Het
Cdhr4 A G 9: 107,996,934 I76V probably benign Het
Copa T C 1: 172,087,667 probably null Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
Cuzd1 C A 7: 131,311,816 K357N possibly damaging Het
Dnah5 T A 15: 28,333,070 F2206I probably damaging Het
Dnase2b T A 3: 146,582,550 K263N probably benign Het
Dync1h1 T A 12: 110,640,980 D2668E probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam124b T C 1: 80,212,986 S227G probably damaging Het
Fam13b T A 18: 34,448,084 Y675F probably damaging Het
Fgf21 T A 7: 45,615,297 M4L probably benign Het
Flg2 T A 3: 93,201,797 C377* probably null Het
Foxp2 T C 6: 15,409,753 S451P probably damaging Het
Gli2 A T 1: 118,835,925 S1499T probably damaging Het
Gm13078 A T 4: 143,726,063 E21D possibly damaging Het
Gm8909 A G 17: 36,167,469 Y224H probably benign Het
Gm9920 A T 15: 55,112,461 probably benign Het
Gpx5 T A 13: 21,287,403 D210V probably damaging Het
Hoxb5 T A 11: 96,305,027 S234T probably benign Het
Irf9 C A 14: 55,606,094 N140K probably benign Het
Isg20 C T 7: 78,914,495 T50M probably damaging Het
Isg20 C A 7: 78,916,586 D94E probably damaging Het
Izumo1 T C 7: 45,624,168 L115P probably damaging Het
Kdm3b G A 18: 34,809,420 E655K probably damaging Het
Kdm5b T G 1: 134,604,634 probably benign Het
Kifc3 A G 8: 95,101,472 probably null Het
Kpna2 T C 11: 106,992,631 S111G probably benign Het
Krt73 A T 15: 101,802,016 N94K probably benign Het
Lgmn G T 12: 102,399,989 D247E probably damaging Het
Lilra6 C T 7: 3,914,936 V70I possibly damaging Het
Lrig3 G A 10: 126,013,526 probably null Het
Lrrc4 T C 6: 28,829,735 H627R probably benign Het
Macf1 G A 4: 123,450,127 probably benign Het
Nat9 C A 11: 115,183,408 probably null Het
Nutm2 A G 13: 50,467,405 D2G probably benign Het
Olfr1151 A G 2: 87,857,752 I192M probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Parl G A 16: 20,287,907 P184L probably damaging Het
Pdzd8 A T 19: 59,300,379 M863K probably damaging Het
Phlda3 T C 1: 135,766,821 S125P probably damaging Het
Pkd1l3 A T 8: 109,650,780 R217* probably null Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Prg4 T C 1: 150,453,547 probably benign Het
Prkab1 A G 5: 116,021,652 probably benign Het
Pyroxd1 A G 6: 142,354,630 E162G possibly damaging Het
R3hcc1l G A 19: 42,582,921 probably null Het
Rgs12 T A 5: 35,030,498 S500T probably damaging Het
Ripor3 T C 2: 167,992,598 D299G probably damaging Het
Robo4 T C 9: 37,402,681 L76P probably damaging Het
Sbno1 T C 5: 124,376,226 Y1302C probably damaging Het
Sec63 A G 10: 42,823,908 I655V possibly damaging Het
Serpina11 T A 12: 103,980,470 M389L probably benign Het
Sfswap C A 5: 129,554,543 P745Q possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slitrk3 C T 3: 73,048,577 S954N probably benign Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sos2 A T 12: 69,617,330 I460N probably benign Het
Spink7 T A 18: 62,594,352 I34L probably benign Het
Srbd1 A G 17: 86,057,745 S628P probably damaging Het
Srm G A 4: 148,593,372 G156S probably damaging Het
Sulf2 T C 2: 166,085,669 probably benign Het
Tmc4 T A 7: 3,666,867 Y6F probably benign Het
Tmcc2 A G 1: 132,360,651 F433L probably damaging Het
Tmprss13 T G 9: 45,337,100 probably benign Het
Tnxb T C 17: 34,699,033 F2307L probably benign Het
Tsr3 A G 17: 25,242,510 E274G probably benign Het
Ttn T C 2: 76,895,144 probably benign Het
Tub T C 7: 109,029,341 V352A possibly damaging Het
Tubb2a A G 13: 34,075,342 I155T possibly damaging Het
Ugt2a2 T C 5: 87,475,001 N36S probably damaging Het
Usp13 T A 3: 32,915,664 probably null Het
Vmn1r52 T G 6: 90,179,611 L120R possibly damaging Het
Vmn2r11 A T 5: 109,054,102 S179T probably benign Het
Vwf A T 6: 125,686,510 R2805W possibly damaging Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp286 T C 11: 62,780,393 T285A possibly damaging Het
Other mutations in Olfr1404
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Olfr1404 APN 1 173215873 missense probably damaging 0.99
IGL01411:Olfr1404 APN 1 173216128 missense probably benign 0.01
IGL02533:Olfr1404 APN 1 173216061 missense probably damaging 0.99
IGL02559:Olfr1404 APN 1 173216521 missense probably damaging 0.98
R0233:Olfr1404 UTSW 1 173216301 missense probably benign 0.25
R0245:Olfr1404 UTSW 1 173215957 missense possibly damaging 0.54
R0652:Olfr1404 UTSW 1 173215957 missense possibly damaging 0.54
R1613:Olfr1404 UTSW 1 173215867 missense probably benign 0.41
R1939:Olfr1404 UTSW 1 173215932 missense probably benign 0.00
R2062:Olfr1404 UTSW 1 173215710 missense probably benign 0.00
R2074:Olfr1404 UTSW 1 173215810 missense probably damaging 0.98
R6045:Olfr1404 UTSW 1 173216500 missense possibly damaging 0.94
R6681:Olfr1404 UTSW 1 173216406 missense probably damaging 1.00
R7192:Olfr1404 UTSW 1 173216008 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCATCTGGGTCACTGGGAATTGG -3'
(R):5'- GTCACTGAGATGAGTCTTTCCTGCC -3'

Sequencing Primer
(F):5'- GGCATGGCTATAGTCCAAGT -3'
(R):5'- TTTCCTGCCCCAGCAAG -3'
Posted On2013-07-11