Incidental Mutation 'R0055:2010300C02Rik'
List |< first << previous [record 40 of 10171] next >> last >|
ID58944
Institutional Source Beutler Lab
Gene Symbol 2010300C02Rik
Ensembl Gene ENSMUSG00000026090
Gene NameRIKEN cDNA 2010300C02 gene
Synonyms
MMRRC Submission 038349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0055 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37611677-37720085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37624256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 854 (S854A)
Ref Sequence ENSEMBL: ENSMUSP00000123803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162875]
Predicted Effect unknown
Transcript: ENSMUST00000160023
AA Change: S329A
SMART Domains Protein: ENSMUSP00000125015
Gene: ENSMUSG00000026090
AA Change: S329A

DomainStartEndE-ValueType
internal_repeat_1 2 65 4.52e-24 PROSPERO
internal_repeat_1 65 128 4.52e-24 PROSPERO
low complexity region 181 194 N/A INTRINSIC
low complexity region 223 237 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
low complexity region 441 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162875
AA Change: S854A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123803
Gene: ENSMUSG00000026090
AA Change: S854A

DomainStartEndE-ValueType
low complexity region 13 43 N/A INTRINSIC
Pfam:DUF4592 130 243 1.8e-33 PFAM
low complexity region 347 366 N/A INTRINSIC
internal_repeat_2 387 461 2.31e-5 PROSPERO
internal_repeat_3 404 474 3.67e-5 PROSPERO
internal_repeat_1 411 526 3.02e-34 PROSPERO
internal_repeat_2 485 559 2.31e-5 PROSPERO
internal_repeat_1 537 652 3.02e-34 PROSPERO
internal_repeat_3 570 698 3.67e-5 PROSPERO
low complexity region 705 718 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 965 989 N/A INTRINSIC
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,968,161 S108R probably damaging Het
2210016F16Rik T C 13: 58,384,166 D192G probably damaging Het
4921501E09Rik A T 17: 33,066,722 W369R probably damaging Het
A2ml1 T C 6: 128,570,094 probably benign Het
Atp6v1h A T 1: 5,084,454 T2S probably benign Het
Bcl11b G A 12: 107,965,777 P179S probably benign Het
Cacna1a C T 8: 84,580,058 probably benign Het
Ccdc146 C T 5: 21,297,006 probably null Het
Ccdc61 T C 7: 18,892,536 D128G probably damaging Het
Cd55 A G 1: 130,459,576 probably benign Het
Cdk7 C A 13: 100,719,304 E99* probably null Het
Cox8a A T 19: 7,217,509 S2T probably damaging Het
Dennd5a A G 7: 109,899,791 I955T possibly damaging Het
Dopey1 A C 9: 86,512,652 E602A probably benign Het
Ephx4 T C 5: 107,413,078 L32S probably damaging Het
Fbxo21 T A 5: 118,000,490 D493E probably benign Het
Frmd4b A T 6: 97,323,649 probably benign Het
Fzd1 A T 5: 4,756,037 M515K possibly damaging Het
Gli2 A G 1: 118,890,408 probably benign Het
Gm12887 T A 4: 121,616,469 K61N probably damaging Het
Grin2a A T 16: 9,669,807 V409D probably damaging Het
Grin2b T C 6: 135,923,203 I227V probably benign Het
Helz2 T G 2: 181,228,821 D2879A possibly damaging Het
Itpr2 T C 6: 146,323,133 N1453S probably benign Het
Itpr3 C A 17: 27,098,322 S817Y probably damaging Het
Lin7c T A 2: 109,896,453 probably benign Het
Ly75 T C 2: 60,321,918 E1097G probably benign Het
Mcm10 T C 2: 4,991,407 N882D probably damaging Het
Mettl13 A T 1: 162,546,181 L167Q probably damaging Het
Morn2 A T 17: 80,295,513 M1L probably benign Het
Mybph G T 1: 134,193,852 V88L probably damaging Het
Nefm T A 14: 68,121,199 probably benign Het
Nf1 A G 11: 79,471,551 E1497G probably damaging Het
Olfr1281 T A 2: 111,328,525 Y35* probably null Het
Olfr137 T C 17: 38,304,811 S217G possibly damaging Het
Olfr615 A G 7: 103,561,037 K187E probably damaging Het
Olfr670 T A 7: 104,960,496 T79S possibly damaging Het
Plcd3 C G 11: 103,077,585 W382S probably damaging Het
Plxna1 T A 6: 89,329,739 I1370F possibly damaging Het
Rarb G A 14: 16,509,066 R106C probably damaging Het
Rps6ka5 G A 12: 100,678,580 T37I probably damaging Het
Runx1 G T 16: 92,644,141 probably benign Het
Scube1 A G 15: 83,634,736 V301A probably damaging Het
Sema3a A T 5: 13,400,037 N27I possibly damaging Het
Slc15a3 G T 19: 10,843,042 E8* probably null Het
Slc22a5 T C 11: 53,891,206 S112G probably benign Het
Slc25a45 T C 19: 5,880,467 F3L probably damaging Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slfn10-ps A G 11: 83,030,300 noncoding transcript Het
Slit2 C A 5: 48,281,726 C1077* probably null Het
Spn A G 7: 127,136,322 F82L possibly damaging Het
Tbccd1 A G 16: 22,841,905 W54R probably damaging Het
Ucp1 G T 8: 83,290,604 E8* probably null Het
Unc80 A T 1: 66,506,623 probably benign Het
Vsnl1 A T 12: 11,386,986 probably null Het
Zdhhc11 C T 13: 73,982,686 Q295* probably null Het
Zfp457 T A 13: 67,294,034 H63L probably damaging Het
Other mutations in 2010300C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:2010300C02Rik APN 1 37628344 missense probably damaging 0.99
IGL01413:2010300C02Rik APN 1 37612306 missense possibly damaging 0.85
IGL01812:2010300C02Rik APN 1 37625365 missense probably benign 0.06
IGL02183:2010300C02Rik APN 1 37625378 missense possibly damaging 0.93
IGL02498:2010300C02Rik APN 1 37623845
IGL02713:2010300C02Rik APN 1 37624137 missense possibly damaging 0.72
IGL02736:2010300C02Rik APN 1 37637873 missense probably damaging 1.00
FR4449:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4449:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4548:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
FR4737:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4737:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4976:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0153:2010300C02Rik UTSW 1 37624639 missense probably benign
R0523:2010300C02Rik UTSW 1 37644629 start codon destroyed probably null 0.94
R0699:2010300C02Rik UTSW 1 37612330 missense possibly damaging 0.85
R0928:2010300C02Rik UTSW 1 37624582 missense possibly damaging 0.85
R1457:2010300C02Rik UTSW 1 37626012 nonsense probably null
R1759:2010300C02Rik UTSW 1 37625710 missense probably benign 0.00
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R2289:2010300C02Rik UTSW 1 37612261 missense possibly damaging 0.53
R2421:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2422:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2509:2010300C02Rik UTSW 1 37625300 missense probably benign
R2510:2010300C02Rik UTSW 1 37625300 missense probably benign
R2511:2010300C02Rik UTSW 1 37625300 missense probably benign
R3893:2010300C02Rik UTSW 1 37631458 missense probably benign 0.00
R4351:2010300C02Rik UTSW 1 37624912 missense probably benign
R4454:2010300C02Rik UTSW 1 37624753 missense probably damaging 1.00
R4788:2010300C02Rik UTSW 1 37631475 missense probably damaging 1.00
R4798:2010300C02Rik UTSW 1 37624965 missense probably benign 0.12
R5599:2010300C02Rik UTSW 1 37613343 missense possibly damaging 0.53
R5920:2010300C02Rik UTSW 1 37637981 missense probably damaging 1.00
R6051:2010300C02Rik UTSW 1 37624225 missense probably damaging 0.98
R6106:2010300C02Rik UTSW 1 37613412 missense possibly damaging 0.53
R6794:2010300C02Rik UTSW 1 37637855 splice site probably null
R6828:2010300C02Rik UTSW 1 37624817 missense possibly damaging 0.53
R6930:2010300C02Rik UTSW 1 37624945 missense possibly damaging 0.73
X0025:2010300C02Rik UTSW 1 37624945 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGTTCATCTTTGGGAAGCAGAGCC -3'
(R):5'- GTCCAAGACAAAGCAGTTGTGCC -3'

Sequencing Primer
(F):5'- TCCAACCTGACTTCGGCG -3'
(R):5'- AAGAGGTTTTCTGTGACCTCCAG -3'
Posted On2013-07-11