Mutagenetix > Incidental Mutation

Incidental Mutation 'R0055:Ucp1'

58973

Institutional Source

Beutler Lab

Gene Symbol

Ucp1

Ensembl Gene

ENSMUSG00000031710

Gene Name

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms

Slc25a7

MMRRC Submission

038349-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84016981-84025081 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 84017233 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 8 (E8*)

Ref Sequence

ENSEMBL: ENSMUSP00000034146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034146]

AlphaFold

P12242

Predicted Effect

probably null
Transcript: ENSMUST00000034146
AA Change: E8*

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: E8*

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	C	6: 128,547,057 (GRCm39)		probably benign	Het
Atp6v1h	A	T	1: 5,154,677 (GRCm39)	T2S	probably benign	Het
Bcl11b	G	A	12: 107,932,036 (GRCm39)	P179S	probably benign	Het
Cacna1a	C	T	8: 85,306,687 (GRCm39)		probably benign	Het
Ccdc146	C	T	5: 21,502,004 (GRCm39)		probably null	Het
Ccdc61	T	C	7: 18,626,461 (GRCm39)	D128G	probably damaging	Het
Cd55	A	G	1: 130,387,313 (GRCm39)		probably benign	Het
Cdk7	C	A	13: 100,855,812 (GRCm39)	E99*	probably null	Het
Cfap96	A	T	8: 46,421,198 (GRCm39)	S108R	probably damaging	Het
Cox8a	A	T	19: 7,194,874 (GRCm39)	S2T	probably damaging	Het
Cracdl	A	C	1: 37,663,337 (GRCm39)	S854A	probably benign	Het
Dennd5a	A	G	7: 109,498,998 (GRCm39)	I955T	possibly damaging	Het
Dop1a	A	C	9: 86,394,705 (GRCm39)	E602A	probably benign	Het
Ephx4	T	C	5: 107,560,944 (GRCm39)	L32S	probably damaging	Het
Fbxo21	T	A	5: 118,138,555 (GRCm39)	D493E	probably benign	Het
Frmd4b	A	T	6: 97,300,610 (GRCm39)		probably benign	Het
Fzd1	A	T	5: 4,806,037 (GRCm39)	M515K	possibly damaging	Het
Gli2	A	G	1: 118,818,138 (GRCm39)		probably benign	Het
Gm12887	T	A	4: 121,473,666 (GRCm39)	K61N	probably damaging	Het
Grin2a	A	T	16: 9,487,671 (GRCm39)	V409D	probably damaging	Het
Grin2b	T	C	6: 135,900,201 (GRCm39)	I227V	probably benign	Het
Helz2	T	G	2: 180,870,614 (GRCm39)	D2879A	possibly damaging	Het
Itpr2	T	C	6: 146,224,631 (GRCm39)	N1453S	probably benign	Het
Itpr3	C	A	17: 27,317,296 (GRCm39)	S817Y	probably damaging	Het
Lin7c	T	A	2: 109,726,798 (GRCm39)		probably benign	Het
Ly75	T	C	2: 60,152,262 (GRCm39)	E1097G	probably benign	Het
Mcm10	T	C	2: 4,996,218 (GRCm39)	N882D	probably damaging	Het
Mettl13	A	T	1: 162,373,750 (GRCm39)	L167Q	probably damaging	Het
Morn2	A	T	17: 80,602,942 (GRCm39)	M1L	probably benign	Het
Mybph	G	T	1: 134,121,590 (GRCm39)	V88L	probably damaging	Het
Nefm	T	A	14: 68,358,648 (GRCm39)		probably benign	Het
Nf1	A	G	11: 79,362,377 (GRCm39)	E1497G	probably damaging	Het
Or2j3	T	C	17: 38,615,702 (GRCm39)	S217G	possibly damaging	Het
Or4k37	T	A	2: 111,158,870 (GRCm39)	Y35*	probably null	Het
Or51ah3	A	G	7: 103,210,244 (GRCm39)	K187E	probably damaging	Het
Or52e18	T	A	7: 104,609,703 (GRCm39)	T79S	possibly damaging	Het
Phf8-ps	A	T	17: 33,285,696 (GRCm39)	W369R	probably damaging	Het
Plcd3	C	G	11: 102,968,411 (GRCm39)	W382S	probably damaging	Het
Plxna1	T	A	6: 89,306,721 (GRCm39)	I1370F	possibly damaging	Het
Qng1	T	C	13: 58,531,980 (GRCm39)	D192G	probably damaging	Het
Rarb	G	A	14: 16,509,066 (GRCm38)	R106C	probably damaging	Het
Rps6ka5	G	A	12: 100,644,839 (GRCm39)	T37I	probably damaging	Het
Runx1	G	T	16: 92,441,029 (GRCm39)		probably benign	Het
Scube1	A	G	15: 83,518,937 (GRCm39)	V301A	probably damaging	Het
Sema3a	A	T	5: 13,450,004 (GRCm39)	N27I	possibly damaging	Het
Slc15a3	G	T	19: 10,820,406 (GRCm39)	E8*	probably null	Het
Slc22a5	T	C	11: 53,782,032 (GRCm39)	S112G	probably benign	Het
Slc25a45	T	C	19: 5,930,495 (GRCm39)	F3L	probably damaging	Het
Slc4a4	A	C	5: 89,304,195 (GRCm39)	H502P	possibly damaging	Het
Slfn10-ps	A	G	11: 82,921,126 (GRCm39)		noncoding transcript	Het
Slit2	C	A	5: 48,439,068 (GRCm39)	C1077*	probably null	Het
Spn	A	G	7: 126,735,494 (GRCm39)	F82L	possibly damaging	Het
Tbccd1	A	G	16: 22,660,655 (GRCm39)	W54R	probably damaging	Het
Unc80	A	T	1: 66,545,782 (GRCm39)		probably benign	Het
Vsnl1	A	T	12: 11,436,987 (GRCm39)		probably null	Het
Zdhhc11	C	T	13: 74,130,805 (GRCm39)	Q295*	probably null	Het
Zfp457	T	A	13: 67,442,098 (GRCm39)	H63L	probably damaging	Het

Other mutations in Ucp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4585001:Ucp1	UTSW	8	84,020,577 (GRCm39)	missense	probably damaging	1.00
R0050:Ucp1	UTSW	8	84,020,857 (GRCm39)	missense	probably damaging	1.00
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0505:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0590:Ucp1	UTSW	8	84,018,232 (GRCm39)	splice site	probably benign
R0681:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0731:Ucp1	UTSW	8	84,024,476 (GRCm39)	splice site	probably benign
R1606:Ucp1	UTSW	8	84,021,933 (GRCm39)	missense	probably damaging	1.00
R1722:Ucp1	UTSW	8	84,017,317 (GRCm39)	missense	probably benign	0.25
R1809:Ucp1	UTSW	8	84,024,496 (GRCm39)	missense	probably damaging	0.99
R1823:Ucp1	UTSW	8	84,020,661 (GRCm39)	missense	probably damaging	1.00
R3809:Ucp1	UTSW	8	84,017,270 (GRCm39)	missense	probably damaging	0.99
R4085:Ucp1	UTSW	8	84,020,580 (GRCm39)	missense	probably benign	0.43
R4673:Ucp1	UTSW	8	84,021,876 (GRCm39)	missense	probably damaging	1.00
R4998:Ucp1	UTSW	8	84,024,484 (GRCm39)	critical splice acceptor site	probably null
R5163:Ucp1	UTSW	8	84,020,832 (GRCm39)	missense	possibly damaging	0.95
R5421:Ucp1	UTSW	8	84,017,320 (GRCm39)	missense	probably benign	0.12
R5790:Ucp1	UTSW	8	84,024,520 (GRCm39)	missense	possibly damaging	0.54
R5994:Ucp1	UTSW	8	84,020,567 (GRCm39)	missense	possibly damaging	0.92
R6574:Ucp1	UTSW	8	84,020,718 (GRCm39)	critical splice donor site	probably null
R6732:Ucp1	UTSW	8	84,018,106 (GRCm39)	missense	probably benign	0.08
R7282:Ucp1	UTSW	8	84,020,531 (GRCm39)	missense	probably benign	0.03
R7343:Ucp1	UTSW	8	84,021,881 (GRCm39)	missense	probably damaging	0.99
R7878:Ucp1	UTSW	8	84,024,521 (GRCm39)	missense	probably benign	0.19
R8008:Ucp1	UTSW	8	84,020,640 (GRCm39)	missense	probably benign	0.32
R8365:Ucp1	UTSW	8	84,020,628 (GRCm39)	missense	probably damaging	0.97
R8899:Ucp1	UTSW	8	84,017,216 (GRCm39)	missense	probably benign	0.35
R9186:Ucp1	UTSW	8	84,017,272 (GRCm39)	nonsense	probably null
R9499:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9551:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9552:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAGGAAGGGACGCTCACCTTTG -3'
(R):5'- ACCCATCAACAGCGGTTCTTCAG -3'

Sequencing Primer
(F):5'- GACGCTCACCTTTGAGCTG -3'
(R):5'- GGTTCTTCAGCCAATCCAAGG -3'

Posted On

2013-07-11