Incidental Mutation 'R0238:Kif14'
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Namekinesin family member 14
SynonymsN-3 kinesin, D1Ertd367e
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R0238 (G1)
Quality Score225
Status Validated
Chromosomal Location136466343-136531511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136527393 bp
Amino Acid Change Glutamic Acid to Glycine at position 1551 (E1551G)
Ref Sequence ENSEMBL: ENSMUSP00000044257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]
Predicted Effect probably damaging
Transcript: ENSMUST00000047817
AA Change: E1551G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: E1551G

KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189413
AA Change: E1601G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: E1601G

low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190220
Predicted Effect probably benign
Transcript: ENSMUST00000201676
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Cul2 A G 18: 3,414,115 probably benign Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hpn G T 7: 31,099,390 probably benign Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Micu2 G A 14: 57,917,378 probably benign Het
Mpl A G 4: 118,456,863 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nbn T C 4: 15,986,672 probably benign Het
Ndufa4 C T 6: 11,906,024 V10I probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Pzp C T 6: 128,489,156 probably benign Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Scgb1b27 G A 7: 34,021,952 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Six3 G A 17: 85,621,390 G51R probably damaging Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Zfp866 T C 8: 69,766,715 Y53C probably damaging Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00159:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00160:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00164:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00310:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00330:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00335:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00434:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00468:Kif14 APN 1 136469018 missense probably benign 0.11
IGL01330:Kif14 APN 1 136476374 missense probably damaging 0.99
IGL01530:Kif14 APN 1 136478419 splice site probably benign
IGL01622:Kif14 APN 1 136497356 splice site probably benign
IGL01689:Kif14 APN 1 136519642 missense probably damaging 0.99
IGL02115:Kif14 APN 1 136496567 splice site probably benign
IGL02252:Kif14 APN 1 136478392 missense probably damaging 1.00
IGL02259:Kif14 APN 1 136500102 missense probably benign
IGL02439:Kif14 APN 1 136490261 missense probably damaging 1.00
IGL02590:Kif14 APN 1 136496004 missense probably benign 0.00
IGL02606:Kif14 APN 1 136496593 missense probably damaging 1.00
IGL03253:Kif14 APN 1 136487460 missense probably damaging 0.97
R0106:Kif14 UTSW 1 136479924 splice site probably benign
R0193:Kif14 UTSW 1 136468438 missense probably benign 0.00
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0329:Kif14 UTSW 1 136496026 splice site probably benign
R0346:Kif14 UTSW 1 136468160 missense probably damaging 1.00
R0393:Kif14 UTSW 1 136482418 missense probably damaging 1.00
R0519:Kif14 UTSW 1 136469147 missense probably damaging 1.00
R0590:Kif14 UTSW 1 136482472 missense probably damaging 0.97
R0633:Kif14 UTSW 1 136527305 missense probably damaging 0.96
R0657:Kif14 UTSW 1 136469102 missense probably benign 0.07
R0831:Kif14 UTSW 1 136525871 splice site probably benign
R0971:Kif14 UTSW 1 136519654 missense probably damaging 0.98
R1018:Kif14 UTSW 1 136495841 splice site probably benign
R1520:Kif14 UTSW 1 136503324 missense probably benign 0.00
R1713:Kif14 UTSW 1 136527464 missense probably benign 0.00
R1728:Kif14 UTSW 1 136468279 missense probably benign
R1728:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1728:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1728:Kif14 UTSW 1 136490332 missense probably benign
R1728:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1728:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1728:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1729:Kif14 UTSW 1 136468279 missense probably benign
R1729:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1729:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1729:Kif14 UTSW 1 136490332 missense probably benign
R1729:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1729:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1729:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1730:Kif14 UTSW 1 136468279 missense probably benign
R1730:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1730:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1730:Kif14 UTSW 1 136490332 missense probably benign
R1730:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1730:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1730:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1739:Kif14 UTSW 1 136468279 missense probably benign
R1739:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1739:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1739:Kif14 UTSW 1 136490332 missense probably benign
R1739:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1739:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1739:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1762:Kif14 UTSW 1 136468279 missense probably benign
R1762:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1762:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1762:Kif14 UTSW 1 136490332 missense probably benign
R1762:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1762:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1762:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1783:Kif14 UTSW 1 136468279 missense probably benign
R1783:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1783:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1783:Kif14 UTSW 1 136490332 missense probably benign
R1783:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1783:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1783:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1784:Kif14 UTSW 1 136468279 missense probably benign
R1784:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1784:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1784:Kif14 UTSW 1 136490332 missense probably benign
R1784:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1784:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1784:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1785:Kif14 UTSW 1 136468279 missense probably benign
R1785:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1785:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1785:Kif14 UTSW 1 136490332 missense probably benign
R1785:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1785:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1785:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1872:Kif14 UTSW 1 136486358 missense probably damaging 1.00
R2049:Kif14 UTSW 1 136487080 missense probably benign
R2049:Kif14 UTSW 1 136510167 missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136519748 nonsense probably null
R2373:Kif14 UTSW 1 136479845 missense probably damaging 1.00
R3076:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136516363 nonsense probably null
R4246:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4247:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136521278 missense probably benign 0.00
R4672:Kif14 UTSW 1 136521279 missense probably benign
R4890:Kif14 UTSW 1 136487130 missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136482959 missense probably damaging 1.00
R5102:Kif14 UTSW 1 136516403 missense probably benign 0.00
R5185:Kif14 UTSW 1 136527469 nonsense probably null
R5201:Kif14 UTSW 1 136503407 missense probably benign 0.00
R5399:Kif14 UTSW 1 136503324 missense probably benign 0.00
R5431:Kif14 UTSW 1 136496695 missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136516390 missense probably benign 0.23
R6027:Kif14 UTSW 1 136483059 intron probably null
R6246:Kif14 UTSW 1 136476424 nonsense probably null
R6331:Kif14 UTSW 1 136515986 missense probably null 1.00
R6448:Kif14 UTSW 1 136503347 missense probably damaging 0.99
R6453:Kif14 UTSW 1 136482304 intron probably null
R6475:Kif14 UTSW 1 136527411 missense probably damaging 1.00
R6631:Kif14 UTSW 1 136515959 missense probably benign 0.39
R6713:Kif14 UTSW 1 136525806 missense probably benign
R7173:Kif14 UTSW 1 136479170 missense probably damaging 0.98
R7174:Kif14 UTSW 1 136521257 missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136468753 missense probably benign 0.41
X0021:Kif14 UTSW 1 136490276 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-07-11