Incidental Mutation 'R0239:Depdc5'
ID59211
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R0239 (G1)
Quality Score223
Status Validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32943240 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 832 (S832P)
Ref Sequence ENSEMBL: ENSMUSP00000052807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000130461]
Predicted Effect probably damaging
Transcript: ENSMUST00000049780
AA Change: S832P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: S832P

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087897
AA Change: S841P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: S841P

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119705
AA Change: S832P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: S832P

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120902
AA Change: S832P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: S832P

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124780
AA Change: S194P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: S194P

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130461
SMART Domains Protein: ENSMUSP00000118681
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 70 82 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137169
AA Change: S238P
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: S238P

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201802
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Greb1l C T 18: 10,458,567 probably benign Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Klc1 A G 12: 111,785,324 probably benign Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Mfsd7a G T 5: 108,444,016 probably benign Het
Micu2 G A 14: 57,917,378 probably benign Het
Mrrf T C 2: 36,177,281 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Pzp C T 6: 128,489,156 probably benign Het
Raet1c C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Scgb1b2 T A 7: 31,291,730 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 utr 3 prime probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 intron probably null
R2938:Depdc5 UTSW 5 32901621 intron probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 unclassified probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAGAAGGTGAAGACTTCCAGC -3'
(R):5'- AATTCAAGATGGTCACCAAGGACGG -3'

Sequencing Primer
(F):5'- GGACCTAGATATGCTCAGGTG -3'
(R):5'- TGGTCACCAAGGACGGTAAAC -3'
Posted On2013-07-11