Incidental Mutation 'R0032:Des'
ID59372
Institutional Source Beutler Lab
Gene Symbol Des
Ensembl Gene ENSMUSG00000026208
Gene Namedesmin
Synonyms
MMRRC Submission 038326-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R0032 (G1) of strain 731
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75360329-75368579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75362166 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 195 (E195G)
Ref Sequence ENSEMBL: ENSMUSP00000027409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027409]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027409
AA Change: E195G

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027409
Gene: ENSMUSG00000026208
AA Change: E195G

DomainStartEndE-ValueType
Pfam:Filament_head 9 105 1.3e-25 PFAM
Filament 106 414 7.41e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144894
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane and are essential for maintaining the strength and integrity of skeletal, cardiac and smooth muscle fibers. Mutations in this gene affect assembly of intermediate filaments. Mice lacking this gene are able to develop and reproduce but exhibit abnormal muscle fibers. Mutations in the human gene are associated with myofibrillar myopathy, dilated cardiomyopathy, neurogenic scapuloperoneal syndrome and autosomal recessive limb-girdle muscular dystrophy, type 2R. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit histologically detectable defects of cardiac, skeletal, and smooth muscle. Defects in the heart are most severe, and lead to calcification, progressive degeneration, and necrosis of the myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Ccbe1 T G 18: 66,291,652 T35P possibly damaging Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdk5rap3 A T 11: 96,908,753 L412Q possibly damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dennd4c T C 4: 86,828,150 probably null Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr800 T A 10: 129,660,400 V198D probably benign Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcsk5 T C 19: 17,564,815 N804S possibly damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tjp2 A G 19: 24,108,695 L821S probably damaging Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Des
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Des APN 1 75362583 missense probably benign 0.02
IGL02416:Des APN 1 75362728 critical splice donor site probably null
IGL02953:Des APN 1 75363644 missense possibly damaging 0.95
IGL03156:Des APN 1 75362996 missense probably damaging 1.00
IGL03288:Des APN 1 75362341 missense possibly damaging 0.79
R0849:Des UTSW 1 75360628 missense probably benign
R0885:Des UTSW 1 75360730 missense probably damaging 1.00
R1271:Des UTSW 1 75360646 missense probably benign 0.01
R1452:Des UTSW 1 75363477 missense probably damaging 1.00
R1559:Des UTSW 1 75360586 missense probably benign 0.11
R1929:Des UTSW 1 75363493 missense probably damaging 0.99
R2144:Des UTSW 1 75366804 missense probably benign 0.45
R2145:Des UTSW 1 75363464 splice site probably benign
R2271:Des UTSW 1 75363493 missense probably damaging 0.99
R4182:Des UTSW 1 75362584 missense probably benign 0.00
R4184:Des UTSW 1 75362584 missense probably benign 0.00
R4383:Des UTSW 1 75360769 missense possibly damaging 0.94
R5268:Des UTSW 1 75362928 missense possibly damaging 0.50
R5787:Des UTSW 1 75363646 missense probably damaging 0.98
R5974:Des UTSW 1 75362984 missense probably benign 0.10
R6044:Des UTSW 1 75363469 critical splice acceptor site probably null
R6985:Des UTSW 1 75366787 missense possibly damaging 0.80
R7359:Des UTSW 1 75360952 missense probably damaging 1.00
R7467:Des UTSW 1 75362961 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GTTTACCCAGATGAGCAGTGTCACC -3'
(R):5'- ATCCTGGCCCGAGGGAAATACAAC -3'

Sequencing Primer
(F):5'- acagaggtggataaaataaaacagag -3'
(R):5'- TACAACGTCAGGGTCAGGAAC -3'
Posted On2013-07-11