Incidental Mutation 'R0032:Dennd4c'
ID59382
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
MMRRC Submission 038326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0032 (G1) of strain 731
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 86828150 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably null
Transcript: ENSMUST00000045512
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000082026
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142837
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Ccbe1 T G 18: 66,291,652 T35P possibly damaging Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdk5rap3 A T 11: 96,908,753 L412Q possibly damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Des A G 1: 75,362,166 E195G possibly damaging Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr800 T A 10: 129,660,400 V198D probably benign Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcsk5 T C 19: 17,564,815 N804S possibly damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tjp2 A G 19: 24,108,695 L821S probably damaging Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCCCATCGAGGTATGTCACATC -3'
(R):5'- GGCCCCATTCCACAAATTCAGTTTCAG -3'

Sequencing Primer
(F):5'- CGAGGTATGTCACATCTTGAATG -3'
(R):5'- AACTGGTCTGGTTGACAATACG -3'
Posted On2013-07-11