Incidental Mutation 'R0032:Dcaf4'
ID59431
Institutional Source Beutler Lab
Gene Symbol Dcaf4
Ensembl Gene ENSMUSG00000021222
Gene NameDDB1 and CUL4 associated factor 4
Synonyms1110018E21Rik, Wdr21
MMRRC Submission 038326-MU
Accession Numbers

Genbank: NM_030246; MGI: 1921078

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0032 (G1) of strain 731
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83520466-83541920 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 83535988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021645] [ENSMUST00000223291]
Predicted Effect probably benign
Transcript: ENSMUST00000021645
SMART Domains Protein: ENSMUSP00000021645
Gene: ENSMUSG00000021222

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Blast:WD40 274 313 2e-14 BLAST
WD40 361 399 8.36e-2 SMART
WD40 402 443 7.4e0 SMART
Blast:WD40 446 494 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222833
Predicted Effect probably benign
Transcript: ENSMUST00000223291
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(39) : Gene trapped(39)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Ccbe1 T G 18: 66,291,652 T35P possibly damaging Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdk5rap3 A T 11: 96,908,753 L412Q possibly damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dennd4c T C 4: 86,828,150 probably null Het
Des A G 1: 75,362,166 E195G possibly damaging Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr800 T A 10: 129,660,400 V198D probably benign Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcsk5 T C 19: 17,564,815 N804S possibly damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tjp2 A G 19: 24,108,695 L821S probably damaging Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Dcaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Dcaf4 APN 12 83539333 missense probably damaging 1.00
IGL01401:Dcaf4 APN 12 83541374 missense probably damaging 1.00
IGL02393:Dcaf4 APN 12 83530031 missense probably damaging 1.00
IGL02970:Dcaf4 APN 12 83529215 missense probably damaging 0.99
F5770:Dcaf4 UTSW 12 83537701 splice site probably null
PIT4504001:Dcaf4 UTSW 12 83534011 critical splice donor site probably null
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0164:Dcaf4 UTSW 12 83535988 splice site probably benign
R0165:Dcaf4 UTSW 12 83535988 splice site probably benign
R0167:Dcaf4 UTSW 12 83535988 splice site probably benign
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0594:Dcaf4 UTSW 12 83538043 critical splice donor site probably null
R1191:Dcaf4 UTSW 12 83535967 missense probably damaging 1.00
R4499:Dcaf4 UTSW 12 83539360 missense probably damaging 1.00
R4896:Dcaf4 UTSW 12 83539459 missense possibly damaging 0.86
R4932:Dcaf4 UTSW 12 83532304 missense possibly damaging 0.61
R5882:Dcaf4 UTSW 12 83539429 missense probably damaging 0.96
R7084:Dcaf4 UTSW 12 83537797 frame shift probably null
V7583:Dcaf4 UTSW 12 83537701 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGAAGAGACGGAAACTGAATGC -3'
(R):5'- GCTGACATGACCTCAAAGGGCTTAC -3'

Sequencing Primer
(F):5'- GGCGTTTTATAACTTCCCAAAGG -3'
(R):5'- CTCAAAGGGCTTACAAAGAGCTG -3'
Posted On2013-07-11