Incidental Mutation 'R0032:Ccbe1'
ID59453
Institutional Source Beutler Lab
Gene Symbol Ccbe1
Ensembl Gene ENSMUSG00000046318
Gene Namecollagen and calcium binding EGF domains 1
Synonyms
MMRRC Submission 038326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0032 (G1) of strain 731
Quality Score148
Status Validated
Chromosome18
Chromosomal Location66045302-66302739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66291652 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 35 (T35P)
Ref Sequence ENSEMBL: ENSMUSP00000117636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061103] [ENSMUST00000130300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061103
AA Change: T35P

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052011
Gene: ENSMUSG00000046318
AA Change: T35P

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 93 134 7.95e0 SMART
EGF_CA 135 176 1.69e-12 SMART
Pfam:Collagen 246 295 7.7e-9 PFAM
Pfam:Collagen 299 337 1.2e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130300
AA Change: T35P

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117636
Gene: ENSMUSG00000046318
AA Change: T35P

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 93 134 7.95e0 SMART
EGF_CA 135 176 1.69e-12 SMART
Pfam:Collagen 246 295 7.4e-9 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153479
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to function in extracellular matrix remodeling and migration. It is predominantly expressed in the ovary, but down regulated in ovarian cancer cell lines and primary carcinomas, suggesting its role as a tumour suppressor. Mutations in this gene have been associated with Hennekam lymphangiectasia-lymphedema syndrome, a generalized lymphatic dysplasia in humans. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with edema and absence of lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdk5rap3 A T 11: 96,908,753 L412Q possibly damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dennd4c T C 4: 86,828,150 probably null Het
Des A G 1: 75,362,166 E195G possibly damaging Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr800 T A 10: 129,660,400 V198D probably benign Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcsk5 T C 19: 17,564,815 N804S possibly damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tjp2 A G 19: 24,108,695 L821S probably damaging Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Ccbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ccbe1 APN 18 66066727 critical splice donor site probably null
R0575:Ccbe1 UTSW 18 66093995 splice site probably benign
R0722:Ccbe1 UTSW 18 66084806 missense probably damaging 1.00
R3122:Ccbe1 UTSW 18 66066829 missense probably benign 0.02
R4642:Ccbe1 UTSW 18 66291583 intron probably benign
R5218:Ccbe1 UTSW 18 66083158 missense probably damaging 1.00
R5334:Ccbe1 UTSW 18 66083245 missense probably damaging 0.99
R5369:Ccbe1 UTSW 18 66061414 missense probably benign 0.00
R5806:Ccbe1 UTSW 18 66076355 nonsense probably null
R5865:Ccbe1 UTSW 18 66083151 missense possibly damaging 0.48
R6752:Ccbe1 UTSW 18 66076307 critical splice donor site probably null
R6763:Ccbe1 UTSW 18 66061388 missense possibly damaging 0.65
R7226:Ccbe1 UTSW 18 66083128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCGCATGAGATGAAAGTCACC -3'
(R):5'- CTGAACGTCCAGAAGAGATTCCCG -3'

Sequencing Primer
(F):5'- TGAAAGTCACCTGGATCAGC -3'
(R):5'- TTAGACAAGCTCGGTTCACC -3'
Posted On2013-07-11