Incidental Mutation 'R0032:Pcsk5'
ID59454
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 038326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0032 (G1) of strain 731
Quality Score225
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17564815 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 804 (N804S)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025618
AA Change: N804S

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: N804S

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050715
AA Change: N804S

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: N804S

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Ccbe1 T G 18: 66,291,652 T35P possibly damaging Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdk5rap3 A T 11: 96,908,753 L412Q possibly damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dennd4c T C 4: 86,828,150 probably null Het
Des A G 1: 75,362,166 E195G possibly damaging Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr800 T A 10: 129,660,400 V198D probably benign Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tjp2 A G 19: 24,108,695 L821S probably damaging Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTGTCCAAAGACACGAAGACC -3'
(R):5'- AGCCATGTTTCACGCAGCTCTCAG -3'

Sequencing Primer
(F):5'- CACGAAGACCGAATTGTCCTTTATC -3'
(R):5'- CCTTGGGAGGAACTTAAATGTCC -3'
Posted On2013-07-11