Incidental Mutation 'R0241:Fmnl1'
ID59504
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Nameformin-like 1
Synonymsformin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission 038479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0241 (G1)
Quality Score98
Status Validated
Chromosome11
Chromosomal Location103171107-103198901 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 103182170 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000107027] [ENSMUST00000218163]
Predicted Effect probably null
Transcript: ENSMUST00000042286
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107027
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107027
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect probably null
Transcript: ENSMUST00000218163
Meta Mutation Damage Score 0.666 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T A 6: 39,583,818 V380E probably benign Het
Anapc1 A T 2: 128,628,629 M1527K possibly damaging Het
Arfgef3 T A 10: 18,599,214 I1575F probably damaging Het
Atp4a G T 7: 30,717,135 G446C probably benign Het
Bicra A T 7: 15,975,145 M1188K probably damaging Het
Brd7 G A 8: 88,345,850 R331W probably benign Het
Cactin A G 10: 81,322,652 T151A probably benign Het
Cadps G A 14: 12,376,675 T1274M probably damaging Het
Catsper3 T C 13: 55,804,854 M175T probably damaging Het
Chd5 A G 4: 152,366,132 D605G probably damaging Het
Chst12 G A 5: 140,524,299 R227H possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cobl A T 11: 12,254,524 V644E probably benign Het
Ddx31 A G 2: 28,848,291 T155A probably damaging Het
Dnah3 T C 7: 119,922,730 Q4069R probably damaging Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Doc2b A G 11: 75,772,561 V355A probably damaging Het
Dock10 A T 1: 80,578,623 S578T probably benign Het
Duox1 T C 2: 122,333,397 probably benign Het
Epb41l5 T C 1: 119,567,779 probably null Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer2a A G 8: 3,688,796 probably null Het
Fry A T 5: 150,260,346 probably benign Het
Git2 T C 5: 114,733,229 E208G probably damaging Het
Gm13757 A T 2: 88,446,545 M131K possibly damaging Het
Hs6st3 T C 14: 119,138,820 F136L probably benign Het
Hydin G A 8: 110,398,023 V555I probably benign Het
Kcns1 A T 2: 164,168,380 I153N probably damaging Het
Kmt2b A G 7: 30,577,069 L1726S probably damaging Het
Loxl3 A G 6: 83,050,133 D615G probably damaging Het
Negr1 T A 3: 157,208,399 probably benign Het
Nfasc C A 1: 132,636,993 A70S probably benign Het
Odf3l2 C T 10: 79,644,730 probably null Het
Olfr464 T A 11: 87,914,034 N291Y probably damaging Het
Olfr658 A G 7: 104,645,243 M41T probably benign Het
Olfr998 A G 2: 85,590,810 K90R probably benign Het
Otud7a T C 7: 63,697,244 probably benign Het
Pacs2 T C 12: 113,069,270 probably benign Het
Pde7b A G 10: 20,436,216 C239R probably damaging Het
Pdzd2 A T 15: 12,367,941 L2654Q probably damaging Het
Pgap1 T C 1: 54,535,951 probably null Het
Proz T A 8: 13,065,356 M124K probably benign Het
Raet1d A G 10: 22,371,429 T135A probably benign Het
Rapgef1 A G 2: 29,702,670 N558S possibly damaging Het
Rpl7 C G 1: 16,103,222 G101A possibly damaging Het
Sec14l1 G A 11: 117,147,098 probably benign Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Simc1 G T 13: 54,550,525 L1319F probably damaging Het
Sspo A G 6: 48,461,495 E1499G possibly damaging Het
Tango6 C T 8: 106,747,361 probably benign Het
Tas2r118 T C 6: 23,969,339 Y241C probably damaging Het
Tbck A G 3: 132,724,875 E344G probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Thop1 T A 10: 81,080,245 probably benign Het
Tmbim7 A T 5: 3,666,866 Y66F probably benign Het
Tmc8 C T 11: 117,786,381 probably benign Het
Tnfrsf19 A G 14: 60,973,592 S216P possibly damaging Het
Trappc2l A G 8: 122,614,393 probably benign Het
Trim67 A G 8: 124,823,190 R520G probably damaging Het
Ubp1 T A 9: 113,966,587 probably null Het
Vil1 T C 1: 74,426,694 L548P probably damaging Het
Wdr3 A G 3: 100,145,657 V593A probably damaging Het
Wdr5 A G 2: 27,533,013 Y243C probably damaging Het
Zan T C 5: 137,421,822 T2858A unknown Het
Zbtb37 A T 1: 161,020,369 V356E probably benign Het
Zfp36 C T 7: 28,378,334 V50I probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGACAAACCACATTGGGTAAGC -3'
(R):5'- AGCTCTATGGTGAGCACAGTGAGG -3'

Sequencing Primer
(F):5'- CTTAGGAAAACTGTGACTCTGGC -3'
(R):5'- TGAGGGAGCAGGAAGGTCC -3'
Posted On2013-07-11