Incidental Mutation 'R0241:Tcam1'
ID59505
Institutional Source Beutler Lab
Gene Symbol Tcam1
Ensembl Gene ENSMUSG00000020712
Gene Nametesticular cell adhesion molecule 1
Synonyms
MMRRC Submission 038479-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0241 (G1)
Quality Score146
Status Validated
Chromosome11
Chromosomal Location106276672-106288745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106284078 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 120 (E120K)
Ref Sequence ENSEMBL: ENSMUSP00000044757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044462] [ENSMUST00000142472]
Predicted Effect probably benign
Transcript: ENSMUST00000044462
AA Change: E120K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044757
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 5.4e-30 PFAM
IG_like 117 214 1.66e2 SMART
IG_like 316 397 5.04e1 SMART
IG 408 478 2.79e0 SMART
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142472
AA Change: E120K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115544
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 3.2e-30 PFAM
Pfam:Ig_2 109 214 1.7e-2 PFAM
Pfam:Ig_2 311 396 5.1e-3 PFAM
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T A 6: 39,583,818 V380E probably benign Het
Anapc1 A T 2: 128,628,629 M1527K possibly damaging Het
Arfgef3 T A 10: 18,599,214 I1575F probably damaging Het
Atp4a G T 7: 30,717,135 G446C probably benign Het
Bicra A T 7: 15,975,145 M1188K probably damaging Het
Brd7 G A 8: 88,345,850 R331W probably benign Het
Cactin A G 10: 81,322,652 T151A probably benign Het
Cadps G A 14: 12,376,675 T1274M probably damaging Het
Catsper3 T C 13: 55,804,854 M175T probably damaging Het
Chd5 A G 4: 152,366,132 D605G probably damaging Het
Chst12 G A 5: 140,524,299 R227H possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cobl A T 11: 12,254,524 V644E probably benign Het
Ddx31 A G 2: 28,848,291 T155A probably damaging Het
Dnah3 T C 7: 119,922,730 Q4069R probably damaging Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Doc2b A G 11: 75,772,561 V355A probably damaging Het
Dock10 A T 1: 80,578,623 S578T probably benign Het
Duox1 T C 2: 122,333,397 probably benign Het
Epb41l5 T C 1: 119,567,779 probably null Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer2a A G 8: 3,688,796 probably null Het
Fmnl1 G A 11: 103,182,170 probably null Het
Fry A T 5: 150,260,346 probably benign Het
Git2 T C 5: 114,733,229 E208G probably damaging Het
Gm13757 A T 2: 88,446,545 M131K possibly damaging Het
Hs6st3 T C 14: 119,138,820 F136L probably benign Het
Hydin G A 8: 110,398,023 V555I probably benign Het
Kcns1 A T 2: 164,168,380 I153N probably damaging Het
Kmt2b A G 7: 30,577,069 L1726S probably damaging Het
Loxl3 A G 6: 83,050,133 D615G probably damaging Het
Negr1 T A 3: 157,208,399 probably benign Het
Nfasc C A 1: 132,636,993 A70S probably benign Het
Odf3l2 C T 10: 79,644,730 probably null Het
Olfr464 T A 11: 87,914,034 N291Y probably damaging Het
Olfr658 A G 7: 104,645,243 M41T probably benign Het
Olfr998 A G 2: 85,590,810 K90R probably benign Het
Otud7a T C 7: 63,697,244 probably benign Het
Pacs2 T C 12: 113,069,270 probably benign Het
Pde7b A G 10: 20,436,216 C239R probably damaging Het
Pdzd2 A T 15: 12,367,941 L2654Q probably damaging Het
Pgap1 T C 1: 54,535,951 probably null Het
Proz T A 8: 13,065,356 M124K probably benign Het
Raet1d A G 10: 22,371,429 T135A probably benign Het
Rapgef1 A G 2: 29,702,670 N558S possibly damaging Het
Rpl7 C G 1: 16,103,222 G101A possibly damaging Het
Sec14l1 G A 11: 117,147,098 probably benign Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Simc1 G T 13: 54,550,525 L1319F probably damaging Het
Sspo A G 6: 48,461,495 E1499G possibly damaging Het
Tango6 C T 8: 106,747,361 probably benign Het
Tas2r118 T C 6: 23,969,339 Y241C probably damaging Het
Tbck A G 3: 132,724,875 E344G probably benign Het
Thop1 T A 10: 81,080,245 probably benign Het
Tmbim7 A T 5: 3,666,866 Y66F probably benign Het
Tmc8 C T 11: 117,786,381 probably benign Het
Tnfrsf19 A G 14: 60,973,592 S216P possibly damaging Het
Trappc2l A G 8: 122,614,393 probably benign Het
Trim67 A G 8: 124,823,190 R520G probably damaging Het
Ubp1 T A 9: 113,966,587 probably null Het
Vil1 T C 1: 74,426,694 L548P probably damaging Het
Wdr3 A G 3: 100,145,657 V593A probably damaging Het
Wdr5 A G 2: 27,533,013 Y243C probably damaging Het
Zan T C 5: 137,421,822 T2858A unknown Het
Zbtb37 A T 1: 161,020,369 V356E probably benign Het
Zfp36 C T 7: 28,378,334 V50I probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Tcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Tcam1 APN 11 106285386 missense probably benign
IGL03396:Tcam1 APN 11 106285386 missense probably benign
IGL03397:Tcam1 APN 11 106285386 missense probably benign
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0306:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0313:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0378:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0380:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0381:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0382:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0393:Tcam1 UTSW 11 106284214 missense probably benign 0.19
R0401:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0448:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0537:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0602:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0669:Tcam1 UTSW 11 106285426 missense possibly damaging 0.94
R0706:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R2307:Tcam1 UTSW 11 106284114 missense probably damaging 1.00
R4957:Tcam1 UTSW 11 106282879 missense probably damaging 1.00
R5050:Tcam1 UTSW 11 106285452 missense possibly damaging 0.93
R5269:Tcam1 UTSW 11 106285527 missense probably benign 0.24
R5437:Tcam1 UTSW 11 106285423 missense probably damaging 1.00
R6235:Tcam1 UTSW 11 106284054 nonsense probably null
R6248:Tcam1 UTSW 11 106282826 missense probably benign 0.17
R6302:Tcam1 UTSW 11 106286450 missense probably damaging 1.00
R7399:Tcam1 UTSW 11 106284085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGCTTCTTATGCCTCTGAGACC -3'
(R):5'- AGAAATTACGCCTGTCATTGTCCCG -3'

Sequencing Primer
(F):5'- GCCTCTGAGACCTCTCTGATAAG -3'
(R):5'- CGGTGGGCTCTGACAGTG -3'
Posted On2013-07-11