Incidental Mutation 'R0632:Cfap54'
ID59727
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0632 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92885096 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 2543 (E2543K)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: E2478K
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: E2478K

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212902
AA Change: E2543K
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCATCAGAAACATTCCCACCTGTG -3'
(R):5'- TTCCTAATGCAAGCTGTGGTCCTG -3'

Sequencing Primer
(F):5'- CATTCCCACCTGTGCAATAAG -3'
(R):5'- GGCCTTCAGGAGAAGCAC -3'
Posted On2013-07-11