Incidental Mutation 'R0632:Zfp957'
ID59739
Institutional Source Beutler Lab
Gene Symbol Zfp957
Ensembl Gene ENSMUSG00000071262
Gene Namezinc finger protein 957
SynonymsAU017455
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R0632 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location79212355-79247369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79212920 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 480 (I480F)
Ref Sequence ENSEMBL: ENSMUSP00000124930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040802] [ENSMUST00000161649]
Predicted Effect probably damaging
Transcript: ENSMUST00000040802
AA Change: I480F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039470
Gene: ENSMUSG00000071262
AA Change: I480F

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161649
AA Change: I480F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124930
Gene: ENSMUSG00000071262
AA Change: I480F

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Meta Mutation Damage Score 0.35 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Other mutations in Zfp957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfp957 APN 14 79213398 missense unknown
IGL01646:Zfp957 APN 14 79213891 missense probably benign 0.00
IGL02692:Zfp957 APN 14 79213385 missense unknown
R1018:Zfp957 UTSW 14 79212742 missense probably damaging 1.00
R1719:Zfp957 UTSW 14 79213996 missense probably damaging 1.00
R2165:Zfp957 UTSW 14 79213613 missense probably benign 0.06
R2411:Zfp957 UTSW 14 79214342 missense unknown
R2517:Zfp957 UTSW 14 79214054 missense probably damaging 0.99
R3195:Zfp957 UTSW 14 79212892 missense probably damaging 1.00
R4825:Zfp957 UTSW 14 79214356 start codon destroyed probably null
R4881:Zfp957 UTSW 14 79213409 missense unknown
R5138:Zfp957 UTSW 14 79212922 missense probably damaging 1.00
R5174:Zfp957 UTSW 14 79213388 missense unknown
R5531:Zfp957 UTSW 14 79213182 missense unknown
R5547:Zfp957 UTSW 14 79213966 missense probably benign 0.03
R5677:Zfp957 UTSW 14 79212767 missense probably damaging 1.00
R5968:Zfp957 UTSW 14 79214056 missense probably damaging 1.00
R6897:Zfp957 UTSW 14 79213904 missense probably damaging 0.98
R6994:Zfp957 UTSW 14 79213690 missense probably damaging 0.99
R7105:Zfp957 UTSW 14 79212962 missense probably benign 0.09
R7214:Zfp957 UTSW 14 79213310 missense unknown
R7264:Zfp957 UTSW 14 79213640 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCATCAATGGCACATGGGTAATGG -3'
(R):5'- ACATCAAAAGGTGGTCCTGAGCG -3'

Sequencing Primer
(F):5'- GTATCGGAAGGTGCAGCC -3'
(R):5'- TAGGTTCAATCTGCGCCAG -3'
Posted On2013-07-11