Incidental Mutation 'R0131:Hp1bp3'
ID60466
Institutional Source Beutler Lab
Gene Symbol Hp1bp3
Ensembl Gene ENSMUSG00000028759
Gene Nameheterochromatin protein 1, binding protein 3
SynonymsHp1bp74
MMRRC Submission 038416-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R0131 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location138216296-138244683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138237209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 348 (S348F)
Ref Sequence ENSEMBL: ENSMUSP00000132614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030541] [ENSMUST00000097836] [ENSMUST00000105825] [ENSMUST00000105826] [ENSMUST00000105827] [ENSMUST00000148681] [ENSMUST00000165861]
Predicted Effect probably damaging
Transcript: ENSMUST00000030541
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030541
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097836
AA Change: S310F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095447
Gene: ENSMUSG00000028759
AA Change: S310F

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 2.82e-18 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105825
AA Change: S310F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101451
Gene: ENSMUSG00000028759
AA Change: S310F

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 1.3e-17 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105826
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101452
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105827
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101453
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148681
AA Change: S184F

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122005
Gene: ENSMUSG00000028759
AA Change: S184F

DomainStartEndE-ValueType
H15 3 60 2.05e-6 SMART
H15 89 156 7.29e-12 SMART
H15 171 239 1.78e-15 SMART
low complexity region 263 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155344
Predicted Effect probably damaging
Transcript: ENSMUST00000165861
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132614
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Meta Mutation Damage Score 0.398 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 90.2%
  • 20x: 71.5%
Validation Efficiency 87% (52/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abca8b T A 11: 109,942,289 Q1195L possibly damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Adgrv1 A T 13: 81,502,995 probably benign Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Arntl2 C A 6: 146,828,103 H471N probably benign Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bicd1 A G 6: 149,512,947 E386G probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Cacna1c T C 6: 118,625,512 I1428V probably damaging Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Cldnd1 T C 16: 58,732,992 L232P probably damaging Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Col3a1 T A 1: 45,328,868 probably benign Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Cyc1 G A 15: 76,344,959 V142I probably benign Het
Dapk3 A G 10: 81,192,307 T265A probably benign Het
Ddx21 A T 10: 62,584,752 M711K possibly damaging Het
Dlg5 A T 14: 24,138,649 L1735Q probably damaging Het
Dse A G 10: 34,153,664 Y341H probably damaging Het
Elmod2 A G 8: 83,319,504 I148T probably damaging Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Faxc A G 4: 21,936,659 D98G probably damaging Het
Fcrls A G 3: 87,258,959 S170P possibly damaging Het
Fsip2 G A 2: 82,991,121 D5733N probably benign Het
Gbe1 T C 16: 70,360,852 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
Gm6327 T C 16: 12,761,045 noncoding transcript Het
Gm9745 T A 13: 8,940,527 probably benign Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Kmt2b A T 7: 30,583,921 C296S probably damaging Het
Lgals4 A G 7: 28,834,232 probably null Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Mylk T C 16: 34,875,504 V203A probably benign Het
Myom2 A G 8: 15,083,329 N407S probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr1037 T C 2: 86,085,500 I92M probably damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Olfr720 T C 14: 14,175,620 D154G probably benign Het
Pate3 A G 9: 35,646,157 C68R probably damaging Het
Pcdh15 A G 10: 74,170,608 D106G probably null Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Proc C T 18: 32,135,898 M11I probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Psg21 A G 7: 18,654,868 Y100H probably benign Het
Pten T A 19: 32,776,069 V45E probably benign Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rab7b T C 1: 131,698,555 L107P probably damaging Het
Rbm47 T A 5: 66,026,529 T244S possibly damaging Het
Rhbdf2 C A 11: 116,605,344 G122C probably damaging Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc12a3 G A 8: 94,340,883 probably benign Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Spg11 T C 2: 122,070,968 E1497G probably damaging Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tet3 C G 6: 83,368,788 G1556R probably damaging Het
Tgfbr3 A G 5: 107,132,816 S693P probably benign Het
Tmcc2 C T 1: 132,380,706 G150D probably benign Het
Tmem216 T C 19: 10,554,606 Y44C probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ubr4 A G 4: 139,464,051 T4127A possibly damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Wrnip1 G A 13: 32,806,864 V369I probably damaging Het
Zc3h12c T A 9: 52,126,623 I305F possibly damaging Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Hp1bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Hp1bp3 APN 4 138240629 missense possibly damaging 0.85
IGL02407:Hp1bp3 APN 4 138240672 missense probably damaging 1.00
IGL03036:Hp1bp3 APN 4 138228732 missense probably damaging 1.00
Supermicro UTSW 4 138225897 missense probably damaging 1.00
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0128:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0130:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0132:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0344:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0522:Hp1bp3 UTSW 4 138222161 missense possibly damaging 0.77
R0652:Hp1bp3 UTSW 4 138228769 missense possibly damaging 0.75
R1240:Hp1bp3 UTSW 4 138229698 missense probably damaging 1.00
R1793:Hp1bp3 UTSW 4 138230509 missense probably damaging 1.00
R1871:Hp1bp3 UTSW 4 138222186 missense probably damaging 1.00
R2018:Hp1bp3 UTSW 4 138221632 missense probably damaging 1.00
R2060:Hp1bp3 UTSW 4 138240672 missense probably damaging 1.00
R2255:Hp1bp3 UTSW 4 138225898 missense probably damaging 0.98
R3721:Hp1bp3 UTSW 4 138239608 missense probably damaging 1.00
R3930:Hp1bp3 UTSW 4 138221707 missense probably benign 0.29
R5042:Hp1bp3 UTSW 4 138222108 start codon destroyed probably null 0.99
R5423:Hp1bp3 UTSW 4 138225897 missense probably damaging 1.00
R5583:Hp1bp3 UTSW 4 138222115 missense probably damaging 1.00
R5597:Hp1bp3 UTSW 4 138221628 start codon destroyed possibly damaging 0.91
R6051:Hp1bp3 UTSW 4 138234304 missense possibly damaging 0.93
R6208:Hp1bp3 UTSW 4 138217170 start gained probably benign
R7077:Hp1bp3 UTSW 4 138239618 missense probably damaging 1.00
X0027:Hp1bp3 UTSW 4 138241673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTATCTGTGCTGAGGCAGGAG -3'
(R):5'- AAACCTAGCACCTGAAAAGCTGAGG -3'

Sequencing Primer
(F):5'- CTGAGGCAGGAGCCGAC -3'
(R):5'- ggatcaaactcacaatcatctatcac -3'
Posted On2013-07-23