Incidental Mutation 'R0123:Chn2'
ID60473
Institutional Source Beutler Lab
Gene Symbol Chn2
Ensembl Gene ENSMUSG00000004633
Gene Namechimerin 2
Synonyms4930557O16Rik, 1700026N20Rik
MMRRC Submission 038408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R0123 (G1)
Quality Score157
Status Validated
Chromosome6
Chromosomal Location54039554-54301810 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 54290451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000067741] [ENSMUST00000114401] [ENSMUST00000114402] [ENSMUST00000146114] [ENSMUST00000203091] [ENSMUST00000203941] [ENSMUST00000204115] [ENSMUST00000204746] [ENSMUST00000204921]
Predicted Effect probably benign
Transcript: ENSMUST00000046856
SMART Domains Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
C1 215 264 1.88e-15 SMART
RhoGAP 288 465 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067741
SMART Domains Protein: ENSMUSP00000066078
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 1.88e-15 SMART
RhoGAP 152 329 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114401
SMART Domains Protein: ENSMUSP00000110043
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 274 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114402
SMART Domains Protein: ENSMUSP00000110044
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 224 2.07e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145111
Predicted Effect probably benign
Transcript: ENSMUST00000146114
SMART Domains Protein: ENSMUSP00000114476
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 29 78 1.88e-15 SMART
RhoGAP 102 279 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203091
SMART Domains Protein: ENSMUSP00000145008
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
Pfam:RhoGAP 155 196 5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203941
SMART Domains Protein: ENSMUSP00000145314
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
RhoGAP 101 225 1.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204115
SMART Domains Protein: ENSMUSP00000145507
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 101 257 3.7e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204746
SMART Domains Protein: ENSMUSP00000144983
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
RhoGAP 101 271 4.7e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204921
SMART Domains Protein: ENSMUSP00000145231
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 152 283 4.9e-37 SMART
Meta Mutation Damage Score 0.1004 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd22 A G 7: 30,867,108 probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Chn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chn2 APN 6 54295922 critical splice donor site probably null
IGL02158:Chn2 APN 6 54300245 unclassified probably benign
IGL02618:Chn2 APN 6 54220437 missense probably damaging 1.00
IGL02807:Chn2 APN 6 54295913 missense possibly damaging 0.80
IGL03357:Chn2 APN 6 54194077 missense probably benign 0.02
R0002:Chn2 UTSW 6 54273113 missense probably benign 0.08
R0225:Chn2 UTSW 6 54290451 splice site probably benign
R1478:Chn2 UTSW 6 54293080 missense probably damaging 1.00
R1905:Chn2 UTSW 6 54286121 missense probably damaging 1.00
R3769:Chn2 UTSW 6 54290411 missense probably damaging 1.00
R3946:Chn2 UTSW 6 54269426 unclassified probably benign
R4125:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4127:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4128:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4614:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R4616:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R5063:Chn2 UTSW 6 54290287 nonsense probably null
R5121:Chn2 UTSW 6 54218561 missense possibly damaging 0.57
R5208:Chn2 UTSW 6 54295801 missense probably damaging 0.97
R5240:Chn2 UTSW 6 54220695 missense probably benign
R5348:Chn2 UTSW 6 54300218 missense probably damaging 0.99
R5861:Chn2 UTSW 6 54290374 missense probably damaging 1.00
R6539:Chn2 UTSW 6 54173461 splice site probably null
R6824:Chn2 UTSW 6 54272953 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGACGCTAATGTGGCTTCCTTG -3'
(R):5'- ACTCCCCGAATGAGTCTCCAGTATG -3'

Sequencing Primer
(F):5'- CACAGATTGTGGGTTAAACGTACAC -3'
(R):5'- tcagatcattgctctctagcc -3'
Posted On2013-07-24