Incidental Mutation 'R0117:Plch2'
ID60554
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0117 (G1)
Quality Score157
Status Validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 154985358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953] [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect probably benign
Transcript: ENSMUST00000030931
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070953
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105631
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105632
Predicted Effect probably benign
Transcript: ENSMUST00000124517
SMART Domains Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 1 77 1.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129386
Predicted Effect probably benign
Transcript: ENSMUST00000135665
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139976
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148934
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175982
Predicted Effect probably benign
Transcript: ENSMUST00000176194
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176620
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 intron probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 intron probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCAGCAACCAGGCTTTTCC -3'
(R):5'- CAAGAATGACTCTGCCTTTCGGTCC -3'

Sequencing Primer
(F):5'- AGCAACCAGGCTTTTCCATTTATAC -3'
(R):5'- TCTTGGAGACTCCTCAGAGAC -3'
Posted On2013-07-24