Incidental Mutation 'R0121:Ubac1'
ID60569
Institutional Source Beutler Lab
Gene Symbol Ubac1
Ensembl Gene ENSMUSG00000036352
Gene Nameubiquitin associated domain containing 1
SynonymsUbadc1, 1110033G07Rik
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R0121 (G1)
Quality Score138
Status Validated
Chromosome2
Chromosomal Location25998543-26021747 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 26008859 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000036509]
Predicted Effect probably null
Transcript: ENSMUST00000036509
SMART Domains Protein: ENSMUSP00000040220
Gene: ENSMUSG00000036352

DomainStartEndE-ValueType
Blast:UBQ 14 94 2e-38 BLAST
low complexity region 108 123 N/A INTRINSIC
UBA 193 230 2e-5 SMART
low complexity region 245 269 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
UBA 294 331 5.92e-8 SMART
STI1 357 396 1.85e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134990
Predicted Effect probably null
Transcript: ENSMUST00000136750
SMART Domains Protein: ENSMUSP00000123115
Gene: ENSMUSG00000036352

DomainStartEndE-ValueType
internal_repeat_1 10 37 4.39e-5 PROSPERO
UBA 128 165 2e-5 SMART
low complexity region 180 204 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
UBA 229 258 5.2e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146363
SMART Domains Protein: ENSMUSP00000117683
Gene: ENSMUSG00000036352

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
UBA 133 170 5.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154336
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Ubac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Ubac1 APN 2 26006568 missense probably damaging 1.00
PIT4403001:Ubac1 UTSW 2 26006597 missense probably benign 0.16
R0029:Ubac1 UTSW 2 26021443 missense probably benign 0.15
R0178:Ubac1 UTSW 2 26021428 missense possibly damaging 0.87
R1839:Ubac1 UTSW 2 26007738 missense possibly damaging 0.70
R1891:Ubac1 UTSW 2 26014962 missense probably benign 0.10
R3716:Ubac1 UTSW 2 26014941 missense probably damaging 1.00
R3717:Ubac1 UTSW 2 26014941 missense probably damaging 1.00
R3718:Ubac1 UTSW 2 26014941 missense probably damaging 1.00
R4602:Ubac1 UTSW 2 25998977 missense probably damaging 1.00
R6742:Ubac1 UTSW 2 26005406 missense possibly damaging 0.89
R7134:Ubac1 UTSW 2 26014962 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGCACTTCTGAAGCACAGCAATAAGG -3'
(R):5'- AAAGGACTCTGGAATCCCCTCATGGC -3'

Sequencing Primer
(F):5'- tcaggcagttcacagcag -3'
(R):5'- AGAGATGGGCTTTCCTGAGA -3'
Posted On2013-07-24