Incidental Mutation 'R0085:Ass1'
ID60573
Institutional Source Beutler Lab
Gene Symbol Ass1
Ensembl Gene ENSMUSG00000076441
Gene Nameargininosuccinate synthetase 1
SynonymsAss-1, ASS, fold
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31470207-31520672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31514819 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 371 (N371Y)
Ref Sequence ENSEMBL: ENSMUSP00000099904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102840]
Predicted Effect probably damaging
Transcript: ENSMUST00000102840
AA Change: N371Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: N371Y

DomainStartEndE-ValueType
Pfam:QueC 6 93 2.8e-7 PFAM
Pfam:Arginosuc_synth 8 403 1.9e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192802
Meta Mutation Damage Score 0.722 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Ass1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ass1 APN 2 31476922 missense probably damaging 1.00
IGL02152:Ass1 APN 2 31492324 missense probably damaging 1.00
R0008:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0083:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0084:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0087:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0183:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0220:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0254:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0302:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0346:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0440:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0472:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0605:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0644:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R1460:Ass1 UTSW 2 31514741 missense probably benign 0.37
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1770:Ass1 UTSW 2 31486516 missense probably benign 0.29
R1908:Ass1 UTSW 2 31493148 nonsense probably null
R2361:Ass1 UTSW 2 31520382 missense probably benign 0.02
R2430:Ass1 UTSW 2 31501496 missense probably damaging 1.00
R3816:Ass1 UTSW 2 31510105 splice site probably benign
R4614:Ass1 UTSW 2 31514783 missense probably damaging 1.00
R4628:Ass1 UTSW 2 31480988 missense probably damaging 1.00
R5007:Ass1 UTSW 2 31501532 missense possibly damaging 0.90
R5069:Ass1 UTSW 2 31510173 missense probably damaging 1.00
R5081:Ass1 UTSW 2 31488653 critical splice donor site probably null
R5315:Ass1 UTSW 2 31492329 missense probably benign 0.21
R5370:Ass1 UTSW 2 31518733 missense possibly damaging 0.56
R6259:Ass1 UTSW 2 31488642 missense possibly damaging 0.80
R6541:Ass1 UTSW 2 31510233 missense probably damaging 0.99
R6731:Ass1 UTSW 2 31514784 missense probably damaging 1.00
R6927:Ass1 UTSW 2 31514801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTAAGGCAGAACCGAGCCTATC -3'
(R):5'- GCGCCACAGCCTAACTTTTATACCC -3'

Sequencing Primer
(F):5'- CCGAGCCTATCAGAAGGTAAG -3'
(R):5'- attactttgcatcagaaaatgacac -3'
Posted On2013-07-24