Incidental Mutation 'R0085:Slc1a4'
ID60574
Institutional Source Beutler Lab
Gene Symbol Slc1a4
Ensembl Gene ENSMUSG00000020142
Gene Namesolute carrier family 1 (glutamate/neutral amino acid transporter), member 4
SynonymsASCT1
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R0085 (G1)
Quality Score149
Status Validated
Chromosome11
Chromosomal Location20302180-20332713 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 20304510 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004634] [ENSMUST00000109594]
Predicted Effect probably benign
Transcript: ENSMUST00000004634
SMART Domains Protein: ENSMUSP00000004634
Gene: ENSMUSG00000020142

DomainStartEndE-ValueType
Pfam:SDF 1 397 2.7e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109594
SMART Domains Protein: ENSMUSP00000105223
Gene: ENSMUSG00000020142

DomainStartEndE-ValueType
Pfam:SDF 44 477 4.2e-121 PFAM
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent neutral amino acid transporter for alanine, serine, cysteine, and threonine. Defects in this gene have been associated with developmental delay, microcephaly, and intellectual disability. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably damaging Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Slc1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Slc1a4 APN 11 20308644 splice site probably benign
IGL01889:Slc1a4 APN 11 20314089 splice site probably benign
IGL02725:Slc1a4 APN 11 20308408 missense probably damaging 1.00
IGL03409:Slc1a4 APN 11 20306506 missense probably damaging 1.00
R0771:Slc1a4 UTSW 11 20306467 missense probably damaging 1.00
R0898:Slc1a4 UTSW 11 20304349 missense probably damaging 1.00
R1326:Slc1a4 UTSW 11 20332159 missense probably damaging 1.00
R1992:Slc1a4 UTSW 11 20304375 missense probably benign 0.31
R2497:Slc1a4 UTSW 11 20332620 start gained probably benign
R3498:Slc1a4 UTSW 11 20313973 missense probably damaging 1.00
R4608:Slc1a4 UTSW 11 20304348 missense probably damaging 1.00
R4631:Slc1a4 UTSW 11 20308452 missense probably damaging 1.00
R4885:Slc1a4 UTSW 11 20304384 missense probably damaging 1.00
R4911:Slc1a4 UTSW 11 20332166 missense probably damaging 1.00
R5533:Slc1a4 UTSW 11 20304417 missense probably benign 0.01
R5548:Slc1a4 UTSW 11 20304429 missense possibly damaging 0.68
R6523:Slc1a4 UTSW 11 20332114 missense probably damaging 1.00
R6863:Slc1a4 UTSW 11 20314001 missense probably damaging 1.00
R6941:Slc1a4 UTSW 11 20304346 missense probably damaging 1.00
X0025:Slc1a4 UTSW 11 20318703 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGGAATTGGGAATGGCTTCCAC -3'
(R):5'- CTCCTGACTGGGCTTCTGAGAAAATG -3'

Sequencing Primer
(F):5'- GGAATGGCTTCCACCTTCAC -3'
(R):5'- ccaggcatacaggcacag -3'
Posted On2013-07-24