Incidental Mutation 'R0086:Bcl2'
ID60576
Institutional Source Beutler Lab
Gene Symbol Bcl2
Ensembl Gene ENSMUSG00000057329
Gene NameB cell leukemia/lymphoma 2
SynonymsD830018M01Rik, C430015F12Rik, Bcl-2
MMRRC Submission 038373-MU
Accession Numbers

MGI: 88138

Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location106538178-106714274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106712562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 107 (R107C)
Ref Sequence ENSEMBL: ENSMUSP00000139856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112751] [ENSMUST00000189999]
Predicted Effect probably damaging
Transcript: ENSMUST00000112751
AA Change: R107C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108371
Gene: ENSMUSG00000057329
AA Change: R107C

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189999
AA Change: R107C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139856
Gene: ENSMUSG00000057329
AA Change: R107C

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show pleiotropic abnormalities including small size, increased postnatal mortality, polycystic kidneys, apoptotic involution of thymus and spleen, graying in the second hair follicle cycle, and reduced numbers of motor, sympathetic and sensory neurons. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(8) Gene trapped(2) Chemically induced(1)          

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Bcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Bcl2 APN 1 106712358 missense possibly damaging 0.95
IGL03076:Bcl2 APN 1 106543307 missense probably benign 0.24
Croce UTSW 1 106543281 missense probably damaging 1.00
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0083:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0107:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0183:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0217:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0219:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0346:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0347:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0348:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0361:Bcl2 UTSW 1 106712694 missense probably damaging 0.96
R0470:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0471:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0601:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0609:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0965:Bcl2 UTSW 1 106712291 missense probably benign 0.13
R1756:Bcl2 UTSW 1 106712392 missense probably damaging 1.00
R2764:Bcl2 UTSW 1 106712436 missense probably damaging 1.00
R4798:Bcl2 UTSW 1 106712608 missense possibly damaging 0.57
R4922:Bcl2 UTSW 1 106712646 missense probably benign 0.00
R6864:Bcl2 UTSW 1 106543281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTGAGATCAAAGCCCAGAC -3'
(R):5'- TTCCAGCCTGAGAGCAACCCAATG -3'

Sequencing Primer
(F):5'- GTTCAGGTACTCAGTCATCCACAG -3'
(R):5'- ACCCAATGCCCGCTGTG -3'
Posted On2013-07-24