Incidental Mutation 'R0089:Syne4'
ID60594
Institutional Source Beutler Lab
Gene Symbol Syne4
Ensembl Gene ENSMUSG00000019737
Gene Namespectrin repeat containing, nuclear envelope family member 4
Synonyms
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0089 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30314807-30319046 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30318919 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 362 (G362E)
Ref Sequence ENSEMBL: ENSMUSP00000055874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054594] [ENSMUST00000060834] [ENSMUST00000098585] [ENSMUST00000098586] [ENSMUST00000136887] [ENSMUST00000137550] [ENSMUST00000176304] [ENSMUST00000176504] [ENSMUST00000176789] [ENSMUST00000177078]
Predicted Effect probably damaging
Transcript: ENSMUST00000054594
AA Change: G362E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055874
Gene: ENSMUSG00000019737
AA Change: G362E

DomainStartEndE-ValueType
Blast:SPEC 96 198 2e-34 BLAST
low complexity region 222 234 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
KASH 335 388 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060834
SMART Domains Protein: ENSMUSP00000051515
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 23 224 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098585
SMART Domains Protein: ENSMUSP00000096184
Gene: ENSMUSG00000074210

DomainStartEndE-ValueType
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098586
SMART Domains Protein: ENSMUSP00000096185
Gene: ENSMUSG00000074211

DomainStartEndE-ValueType
Pfam:Complex1_LYR 9 63 2.1e-16 PFAM
Pfam:Complex1_LYR_1 9 65 5.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135882
Predicted Effect probably benign
Transcript: ENSMUST00000136887
SMART Domains Protein: ENSMUSP00000121953
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 3 210 2.1e-16 PFAM
Pfam:2OG-FeII_Oxy 82 213 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176253
Predicted Effect possibly damaging
Transcript: ENSMUST00000176304
AA Change: G279E

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135637
Gene: ENSMUSG00000019737
AA Change: G279E

DomainStartEndE-ValueType
Blast:SPEC 96 196 3e-34 BLAST
low complexity region 197 232 N/A INTRINSIC
KASH 252 305 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176504
SMART Domains Protein: ENSMUSP00000135844
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 92 170 2e-33 BLAST
low complexity region 194 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176536
Predicted Effect probably benign
Transcript: ENSMUST00000176571
Predicted Effect probably benign
Transcript: ENSMUST00000176789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176984
Predicted Effect probably benign
Transcript: ENSMUST00000177078
SMART Domains Protein: ENSMUSP00000135895
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 88 150 4e-24 BLAST
low complexity region 174 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177395
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss associated with outer hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Syne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Syne4 APN 7 30316563 splice site probably null
IGL02386:Syne4 APN 7 30316234 missense possibly damaging 0.91
R0091:Syne4 UTSW 7 30318919 missense probably damaging 0.99
R0448:Syne4 UTSW 7 30314920 start gained probably benign
R0555:Syne4 UTSW 7 30316744 missense probably damaging 0.99
R1205:Syne4 UTSW 7 30315336 missense probably damaging 0.96
R1862:Syne4 UTSW 7 30316883 missense probably benign 0.06
R1863:Syne4 UTSW 7 30316883 missense probably benign 0.06
R4776:Syne4 UTSW 7 30316833 splice site probably benign
R5325:Syne4 UTSW 7 30318976 missense probably damaging 1.00
R6145:Syne4 UTSW 7 30316563 splice site probably null
R6479:Syne4 UTSW 7 30316915 nonsense probably null
Z1088:Syne4 UTSW 7 30316336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCCTGATGCAATGCTGGAAG -3'
(R):5'- TGCCCTCAAGGCAAAGGAATACAAG -3'

Sequencing Primer
(F):5'- CAATGCTGGAAGTGGATCGC -3'
(R):5'- AGGAGCTGTCAGAACACAC -3'
Posted On2013-07-24