Incidental Mutation 'R0165:Gdap1l1'
ID60676
Institutional Source Beutler Lab
Gene Symbol Gdap1l1
Ensembl Gene ENSMUSG00000017943
Gene Nameganglioside-induced differentiation-associated protein 1-like 1
Synonyms
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R0165 (G1)
Quality Score136
Status Validated
Chromosome2
Chromosomal Location163438476-163455324 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 163451499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018087] [ENSMUST00000109420] [ENSMUST00000109421] [ENSMUST00000137070]
Predicted Effect probably null
Transcript: ENSMUST00000018087
SMART Domains Protein: ENSMUSP00000018087
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109420
SMART Domains Protein: ENSMUSP00000105047
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109421
SMART Domains Protein: ENSMUSP00000105048
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 123 1.2e-8 PFAM
Pfam:GST_N_3 49 129 3.3e-10 PFAM
Pfam:GST_N_2 62 124 7.6e-9 PFAM
Pfam:GST_C_2 182 307 8.2e-9 PFAM
Pfam:GST_C 201 311 3.4e-8 PFAM
transmembrane domain 343 365 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137070
SMART Domains Protein: ENSMUSP00000119421
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 120 2.3e-8 PFAM
Pfam:GST_N_3 49 126 1.6e-13 PFAM
Pfam:GST_N_2 55 121 1.1e-9 PFAM
Pfam:GST_C_2 142 246 3.1e-8 PFAM
Pfam:GST_C 146 251 1.6e-6 PFAM
Meta Mutation Damage Score 0.564 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Gdap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Gdap1l1 APN 2 163453668 missense probably damaging 1.00
IGL02171:Gdap1l1 APN 2 163447550 missense possibly damaging 0.78
IGL02335:Gdap1l1 APN 2 163447595 missense possibly damaging 0.50
F5770:Gdap1l1 UTSW 2 163447486 intron probably benign
R0091:Gdap1l1 UTSW 2 163446091 missense probably damaging 1.00
R0242:Gdap1l1 UTSW 2 163447653 nonsense probably null
R1577:Gdap1l1 UTSW 2 163438604 missense probably damaging 0.96
R2022:Gdap1l1 UTSW 2 163447597 missense probably benign 0.04
R4960:Gdap1l1 UTSW 2 163453859 missense probably benign 0.00
R6027:Gdap1l1 UTSW 2 163451611 missense possibly damaging 0.57
R6292:Gdap1l1 UTSW 2 163451507 missense probably damaging 1.00
R6678:Gdap1l1 UTSW 2 163438654 missense probably benign
R7034:Gdap1l1 UTSW 2 163446145 missense probably damaging 1.00
R7173:Gdap1l1 UTSW 2 163438688 missense probably damaging 0.99
R7195:Gdap1l1 UTSW 2 163446130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTGAGCCGTGTCACATACAG -3'
(R):5'- CAAAGATGTCCCCTTTCAGGGTCAG -3'

Sequencing Primer
(F):5'- CCGTGTCACATACAGGAGGG -3'
(R):5'- ACTTGTCAAGGCCACTGC -3'
Posted On2013-07-24