Incidental Mutation 'R0165:Ahrr'
ID60681
Institutional Source Beutler Lab
Gene Symbol Ahrr
Ensembl Gene ENSMUSG00000021575
Gene Namearyl-hydrocarbon receptor repressor
Synonyms
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0165 (G1)
Quality Score204
Status Validated
Chromosome13
Chromosomal Location74211118-74292331 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 74283024 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022059] [ENSMUST00000109640]
Predicted Effect probably benign
Transcript: ENSMUST00000022059
SMART Domains Protein: ENSMUSP00000022059
Gene: ENSMUSG00000021575

DomainStartEndE-ValueType
HLH 32 86 1.1e-11 SMART
PAS 108 174 6.6e-14 SMART
low complexity region 236 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109640
SMART Domains Protein: ENSMUSP00000105268
Gene: ENSMUSG00000021575

DomainStartEndE-ValueType
Blast:PAS 1 46 1e-27 BLAST
PDB:4M4X|B 1 142 2e-30 PDB
SCOP:d1jnua_ 2 63 7e-3 SMART
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: This gene encodes a protein that represses aryl hydrocarbon receptor-dependent signaling. The encoded protein competes with the aryl hydrocarbon receptor transcription factor for heterodimerization with the aryl hydrocarbon receptor nuclear translocator protein and binding to xenobiotic response element (XRE) sequence in many genes. This protein is implicated in the regulation of cell growth and differentiation as well as mediating dioxin toxicity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Ahrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Ahrr APN 13 74220573 missense possibly damaging 0.52
IGL03143:Ahrr APN 13 74257495 nonsense probably null
calico_jack UTSW 13 74222912 missense possibly damaging 0.51
R0009:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0040:Ahrr UTSW 13 74283024 splice site probably benign
R0079:Ahrr UTSW 13 74283024 splice site probably benign
R0082:Ahrr UTSW 13 74283024 splice site probably benign
R0164:Ahrr UTSW 13 74283024 splice site probably benign
R0167:Ahrr UTSW 13 74283024 splice site probably benign
R0310:Ahrr UTSW 13 74283024 splice site probably benign
R0344:Ahrr UTSW 13 74214586 missense probably damaging 1.00
R0948:Ahrr UTSW 13 74213769 missense probably damaging 1.00
R1192:Ahrr UTSW 13 74214403 missense probably benign 0.00
R1438:Ahrr UTSW 13 74224868 nonsense probably null
R1532:Ahrr UTSW 13 74213707 missense probably benign 0.01
R1600:Ahrr UTSW 13 74214378 missense probably benign 0.00
R2302:Ahrr UTSW 13 74277661 missense probably damaging 1.00
R3055:Ahrr UTSW 13 74224887 missense probably damaging 1.00
R4683:Ahrr UTSW 13 74224766 splice site silent
R4717:Ahrr UTSW 13 74215766 missense probably benign 0.03
R4769:Ahrr UTSW 13 74214212 missense probably damaging 1.00
R5998:Ahrr UTSW 13 74213836 missense probably damaging 0.99
R6225:Ahrr UTSW 13 74222912 missense possibly damaging 0.51
R7156:Ahrr UTSW 13 74229916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCACTTTCCACAGACAGAATGAC -3'
(R):5'- TGAGGGCCAATGGATCGTACTGAC -3'

Sequencing Primer
(F):5'- CCACAGACAGAATGACTTATTGCTG -3'
(R):5'- AATGGATCGTACTGACCTTCTTG -3'
Posted On2013-07-24