Incidental Mutation 'R0165:Ltn1'
ID60683
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0165 (G1)
Quality Score148
Status Validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 87405519 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449]
Predicted Effect probably benign
Transcript: ENSMUST00000039449
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCATAGCTACAACATTGCAGGTGC -3'
(R):5'- AGTTGCAGAGCTGCTGTATTCACTG -3'

Sequencing Primer
(F):5'- aaagtcgccctctgctg -3'
(R):5'- TGCAGTGGTGTGAAGAACTC -3'
Posted On2013-07-24