Incidental Mutation 'R0196:Oas3'
ID60755
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0196 (G1)
Quality Score204
Status Not validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120756145 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 39 (R39C)
Ref Sequence ENSEMBL: ENSMUSP00000125873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833] [ENSMUST00000165820]
Predicted Effect probably damaging
Transcript: ENSMUST00000044833
AA Change: R1047C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: R1047C

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165820
AA Change: R39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125873
Gene: ENSMUSG00000032661
AA Change: R39C

DomainStartEndE-ValueType
Pfam:OAS1_C 1 130 3.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200795
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGGTGACCCAGAAGCTGACTAC -3'
(R):5'- TGCCAATGTGAACCTACACATCTCC -3'

Sequencing Primer
(F):5'- AGCACCACTCTGGGAAGC -3'
(R):5'- GTGAACCTACACATCTCCTGTCC -3'
Posted On2013-07-24