Incidental Mutation 'R0197:Wiz'
ID60774
Institutional Source Beutler Lab
Gene Symbol Wiz
Ensembl Gene ENSMUSG00000024050
Gene Namewidely-interspaced zinc finger motifs
Synonyms
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0197 (G1)
Quality Score116
Status Validated
Chromosome17
Chromosomal Location32354055-32389401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32356441 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 907 (I907N)
Ref Sequence ENSEMBL: ENSMUSP00000126253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064694] [ENSMUST00000087703] [ENSMUST00000163107] [ENSMUST00000169488] [ENSMUST00000170617]
Predicted Effect probably damaging
Transcript: ENSMUST00000064694
AA Change: I898N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069443
Gene: ENSMUSG00000024050
AA Change: I898N

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 532 554 1.67e-2 SMART
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
ZnF_C2H2 702 724 1.41e0 SMART
low complexity region 784 793 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
ZnF_C2H2 901 927 1.06e2 SMART
low complexity region 936 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087703
AA Change: I897N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050
AA Change: I897N

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169488
AA Change: I907N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126253
Gene: ENSMUSG00000024050
AA Change: I907N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
ZnF_C2H2 54 76 4.72e-2 SMART
ZnF_C2H2 227 249 3.52e-1 SMART
low complexity region 294 318 N/A INTRINSIC
ZnF_C2H2 357 379 1.67e-2 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 448 467 N/A INTRINSIC
ZnF_C2H2 541 563 1.67e-2 SMART
low complexity region 585 597 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ZnF_C2H2 711 733 1.41e0 SMART
low complexity region 793 802 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
ZnF_C2H2 910 936 1.06e2 SMART
low complexity region 945 965 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Wiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Wiz APN 17 32356919 missense probably benign 0.43
IGL02176:Wiz APN 17 32356902 missense probably damaging 0.96
IGL02212:Wiz APN 17 32368135 missense probably damaging 1.00
IGL02213:Wiz APN 17 32367860 missense probably benign 0.03
IGL02616:Wiz APN 17 32359469 missense probably damaging 1.00
IGL02654:Wiz APN 17 32359350 missense probably damaging 1.00
IGL02833:Wiz APN 17 32357879 missense probably damaging 1.00
IGL03032:Wiz APN 17 32356558 missense probably benign
E0370:Wiz UTSW 17 32355118 missense probably damaging 1.00
IGL03138:Wiz UTSW 17 32359119 missense probably damaging 1.00
R0207:Wiz UTSW 17 32357033 missense probably damaging 1.00
R0701:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0883:Wiz UTSW 17 32356441 missense probably damaging 1.00
R1055:Wiz UTSW 17 32387642 missense probably damaging 0.99
R1968:Wiz UTSW 17 32359372 missense probably damaging 1.00
R2225:Wiz UTSW 17 32356925 missense probably damaging 1.00
R2423:Wiz UTSW 17 32361885 missense probably damaging 1.00
R2860:Wiz UTSW 17 32361706 missense probably damaging 1.00
R2861:Wiz UTSW 17 32361706 missense probably damaging 1.00
R3056:Wiz UTSW 17 32357697 missense probably benign 0.01
R3755:Wiz UTSW 17 32359132 missense probably damaging 1.00
R3885:Wiz UTSW 17 32357038 missense possibly damaging 0.48
R3933:Wiz UTSW 17 32357898 missense probably damaging 1.00
R4038:Wiz UTSW 17 32359224 missense probably damaging 1.00
R4118:Wiz UTSW 17 32369357 utr 3 prime probably benign
R4181:Wiz UTSW 17 32367985 missense probably damaging 1.00
R4651:Wiz UTSW 17 32357681 missense probably damaging 1.00
R4822:Wiz UTSW 17 32356437 nonsense probably null
R4891:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R4923:Wiz UTSW 17 32361596 missense probably benign 0.01
R5014:Wiz UTSW 17 32359366 missense probably damaging 1.00
R5194:Wiz UTSW 17 32377848 utr 3 prime probably benign
R5254:Wiz UTSW 17 32378496 splice site probably benign
R5944:Wiz UTSW 17 32357697 missense probably benign 0.01
R6015:Wiz UTSW 17 32387600 missense probably damaging 0.99
R6263:Wiz UTSW 17 32360443 intron probably null
R6571:Wiz UTSW 17 32359324 missense probably damaging 1.00
R6823:Wiz UTSW 17 32360421 missense probably damaging 0.99
U24488:Wiz UTSW 17 32387675 missense probably damaging 1.00
X0026:Wiz UTSW 17 32387758 start codon destroyed probably null 0.94
Predicted Primers PCR Primer
(F):5'- GTTCCACTGTCCATGAGAAGAACCC -3'
(R):5'- CCCTTTGTGCTCACTGAAAGCAGG -3'

Sequencing Primer
(F):5'- TGAGAAGAACCCCTTAACCTGG -3'
(R):5'- CTCTGTCCATTAGAATTTGAACGC -3'
Posted On2013-07-24