Incidental Mutation 'R0144:Phlpp2'
ID60798
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0144 (G1)
Quality Score207
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109907513 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 242 (R242W)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably damaging
Transcript: ENSMUST00000034175
AA Change: R207W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: R207W

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154262
Predicted Effect probably damaging
Transcript: ENSMUST00000179721
AA Change: R242W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: R242W

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTCTGCCAAGATTCAGAAGC -3'
(R):5'- GATGGTCACTTGCTGCTACATCCTC -3'

Sequencing Primer
(F):5'- catgtacccccacatccag -3'
(R):5'- GCTACATCCTCATCTCTATCCAAG -3'
Posted On2013-07-24