Incidental Mutation 'R0147:Svep1'
ID60821
Institutional Source Beutler Lab
Gene Symbol Svep1
Ensembl Gene ENSMUSG00000028369
Gene Namesushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
SynonymsD430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik
MMRRC Submission 038431-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R0147 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58042442-58206859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58116608 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 881 (D881N)
Ref Sequence ENSEMBL: ENSMUSP00000045856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042850
AA Change: D881N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: D881N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 51 60 N/A INTRINSIC
VWA 82 261 2.18e-32 SMART
Pfam:GCC2_GCC3 311 361 3.4e-14 PFAM
CCP 379 434 3.62e-8 SMART
CCP 439 494 1.78e-16 SMART
CCP 499 559 2.13e-5 SMART
Pfam:HYR 560 642 1.7e-20 PFAM
Pfam:HYR 643 722 4.6e-15 PFAM
CCP 727 787 3.59e-1 SMART
low complexity region 862 873 N/A INTRINSIC
Pfam:GCC2_GCC3 1004 1051 3.2e-16 PFAM
Pfam:GCC2_GCC3 1058 1105 5.4e-19 PFAM
Pfam:GCC2_GCC3 1112 1159 7.7e-19 PFAM
EGF 1195 1228 3.12e-7 SMART
EGF_CA 1230 1266 3.93e-13 SMART
EGF_CA 1268 1304 8.3e-12 SMART
EGF_CA 1306 1342 4.59e-14 SMART
EGF_CA 1344 1380 8.69e-15 SMART
EGF_CA 1382 1418 3.42e-13 SMART
Pfam:Pentaxin 1429 1622 1.8e-28 PFAM
Pfam:Laminin_G_3 1432 1589 1.1e-20 PFAM
CCP 1630 1684 1.71e-9 SMART
CCP 1689 1742 2.31e-15 SMART
EGF_CA 1744 1783 5.23e-9 SMART
CCP 1788 1841 4.62e-15 SMART
CCP 1846 1899 8.29e-17 SMART
CCP 1904 1957 1.1e-12 SMART
CCP 1962 2015 5.6e-14 SMART
CCP 2020 2077 4.15e-8 SMART
CCP 2082 2140 8.11e-11 SMART
CCP 2145 2198 4.38e-16 SMART
CCP 2203 2258 1.69e-8 SMART
CCP 2263 2317 1.42e-15 SMART
CCP 2322 2375 3.1e-7 SMART
CCP 2380 2434 4.55e-14 SMART
CCP 2439 2492 6.95e-10 SMART
CCP 2497 2550 8.88e-17 SMART
CCP 2555 2607 1.7e-13 SMART
CCP 2651 2709 1.02e-7 SMART
CCP 2714 2767 9.6e-13 SMART
CCP 2772 2825 3.64e-13 SMART
CCP 2830 2883 6.63e-16 SMART
CCP 2888 2941 2.76e-13 SMART
CCP 2946 2999 4.41e-12 SMART
CCP 3004 3055 4.25e-5 SMART
CCP 3060 3113 5.15e-13 SMART
CCP 3118 3172 2.11e-9 SMART
CCP 3177 3232 1.02e-7 SMART
CCP 3237 3290 6.19e-16 SMART
CCP 3295 3348 5.35e-11 SMART
CCP 3353 3407 8.43e-9 SMART
CCP 3412 3464 2.44e-14 SMART
EGF 3467 3496 1.28e-3 SMART
EGF 3499 3528 1.15e-5 SMART
EGF 3531 3560 2.85e-1 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,189,271 R594C probably damaging Het
A2m T C 6: 121,662,446 probably null Het
Abtb2 A G 2: 103,567,135 I137V probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Arl6 T C 16: 59,618,790 probably benign Het
Avl9 T A 6: 56,736,502 D248E probably benign Het
Becn1 T C 11: 101,301,736 E40G probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Btbd16 C T 7: 130,779,594 T19I probably damaging Het
Casc3 T A 11: 98,822,499 N246K possibly damaging Het
Celf1 G T 2: 91,004,690 probably benign Het
Chrm3 G T 13: 9,878,744 N85K probably damaging Het
Cluh T A 11: 74,665,938 Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a5 T C 9: 105,925,794 D1324G unknown Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
D630003M21Rik C T 2: 158,203,067 probably benign Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dnmt3b T G 2: 153,661,457 N9K possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam208a A G 14: 27,471,768 D975G probably benign Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fam98c T A 7: 29,152,721 R340* probably null Het
Fbxw10 T G 11: 62,847,481 probably null Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Grid2 T C 6: 64,533,587 Y734H probably benign Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Hectd3 T C 4: 116,997,040 probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Ip6k1 T A 9: 108,045,894 D408E probably damaging Het
Irs2 A T 8: 11,007,568 M288K probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Knop1 C A 7: 118,845,838 R301L probably benign Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mprip T A 11: 59,737,073 D93E possibly damaging Het
Mtmr14 T A 6: 113,260,666 probably benign Het
Muc5ac T C 7: 141,811,039 S1917P probably benign Het
Muc6 C T 7: 141,651,990 C75Y probably damaging Het
Naip1 A T 13: 100,426,910 H582Q possibly damaging Het
Nbeal2 G A 9: 110,642,143 R264* probably null Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nsmce2 T G 15: 59,378,957 S26A probably damaging Het
Olfr1026 T A 2: 85,924,018 I250N possibly damaging Het
Olfr601 T C 7: 103,358,406 T263A possibly damaging Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pax1 A G 2: 147,373,734 S424G probably benign Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Plxna1 C T 6: 89,320,710 A1831T possibly damaging Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Pygo2 T C 3: 89,433,303 V299A probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rnf13 A G 3: 57,802,468 D144G probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Sec23ip C T 7: 128,779,051 probably benign Het
Slc25a26 T A 6: 94,592,526 probably null Het
Slc6a7 A G 18: 61,002,111 probably benign Het
Slco6b1 A T 1: 96,987,837 noncoding transcript Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Spata22 T A 11: 73,331,153 M1K probably null Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tm9sf4 G T 2: 153,195,313 V365L probably benign Het
Tmc3 T C 7: 83,607,742 V401A probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Unc5b A T 10: 60,772,297 S675T probably damaging Het
Vmn1r217 A G 13: 23,113,937 M265T probably benign Het
Vps54 T A 11: 21,300,259 D548E probably benign Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfp710 T A 7: 80,081,973 C299* probably null Het
Other mutations in Svep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Svep1 APN 4 58176077 missense probably damaging 0.98
IGL00489:Svep1 APN 4 58068988 missense possibly damaging 0.71
IGL00496:Svep1 APN 4 58069001 missense possibly damaging 0.95
IGL00864:Svep1 APN 4 58068533 nonsense probably null
IGL00904:Svep1 APN 4 58097398 missense probably benign 0.00
IGL00935:Svep1 APN 4 58090664 missense possibly damaging 0.71
IGL00963:Svep1 APN 4 58072791 nonsense probably null
IGL01077:Svep1 APN 4 58068760 missense possibly damaging 0.71
IGL01084:Svep1 APN 4 58111419 missense possibly damaging 0.71
IGL01150:Svep1 APN 4 58070302 missense probably benign 0.04
IGL01161:Svep1 APN 4 58146569 missense probably damaging 0.96
IGL01360:Svep1 APN 4 58116554 missense possibly damaging 0.73
IGL01365:Svep1 APN 4 58100878 critical splice acceptor site probably null
IGL01396:Svep1 APN 4 58068552 missense possibly damaging 0.85
IGL01601:Svep1 APN 4 58084872 missense probably damaging 1.00
IGL01636:Svep1 APN 4 58116622 missense possibly damaging 0.96
IGL01838:Svep1 APN 4 58121910 missense possibly damaging 0.72
IGL01949:Svep1 APN 4 58176006 missense probably damaging 1.00
IGL01984:Svep1 APN 4 58068877 missense possibly damaging 0.93
IGL02005:Svep1 APN 4 58069056 missense possibly damaging 0.93
IGL02036:Svep1 APN 4 58088245 missense possibly damaging 0.85
IGL02039:Svep1 APN 4 58123980 critical splice donor site probably null
IGL02043:Svep1 APN 4 58068556 missense probably benign 0.19
IGL02073:Svep1 APN 4 58070104 missense probably benign 0.06
IGL02188:Svep1 APN 4 58068382 missense possibly damaging 0.71
IGL02256:Svep1 APN 4 58070311 missense possibly damaging 0.71
IGL02284:Svep1 APN 4 58072819 missense probably benign 0.32
IGL02323:Svep1 APN 4 58070236 nonsense probably null
IGL02440:Svep1 APN 4 58145293 missense probably benign 0.06
IGL02449:Svep1 APN 4 58070296 missense possibly damaging 0.71
IGL02501:Svep1 APN 4 58145341 splice site probably benign
IGL02568:Svep1 APN 4 58135441 missense probably benign 0.42
IGL02625:Svep1 APN 4 58115807 missense possibly damaging 0.53
IGL02795:Svep1 APN 4 58123223 missense probably damaging 1.00
IGL02818:Svep1 APN 4 58069804 missense possibly damaging 0.71
IGL02871:Svep1 APN 4 58100871 missense probably benign
IGL02875:Svep1 APN 4 58082821 splice site probably benign
IGL02887:Svep1 APN 4 58145301 missense probably damaging 1.00
IGL03240:Svep1 APN 4 58048188 missense possibly damaging 0.73
IGL03243:Svep1 APN 4 58133387 missense probably benign 0.06
IGL03264:Svep1 APN 4 58066422 splice site probably benign
IGL03288:Svep1 APN 4 58116532 missense probably benign 0.01
IGL03340:Svep1 APN 4 58111451 missense possibly damaging 0.96
IGL03341:Svep1 APN 4 58070308 nonsense probably null
IGL03348:Svep1 APN 4 58113635 missense probably damaging 1.00
R0001:Svep1 UTSW 4 58066460 missense possibly damaging 0.93
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0125:Svep1 UTSW 4 58099937 splice site probably benign
R0142:Svep1 UTSW 4 58118232 missense probably benign 0.33
R0148:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0157:Svep1 UTSW 4 58069830 missense possibly damaging 0.72
R0195:Svep1 UTSW 4 58089514 missense possibly damaging 0.82
R0197:Svep1 UTSW 4 58070851 missense possibly damaging 0.71
R0257:Svep1 UTSW 4 58179610 missense possibly damaging 0.71
R0314:Svep1 UTSW 4 58096331 missense possibly damaging 0.71
R0316:Svep1 UTSW 4 58072737 missense probably damaging 0.98
R0322:Svep1 UTSW 4 58057996 splice site probably benign
R0426:Svep1 UTSW 4 58073333 missense possibly damaging 0.87
R0446:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R0457:Svep1 UTSW 4 58118136 missense probably damaging 1.00
R0471:Svep1 UTSW 4 58054700 missense possibly damaging 0.85
R0555:Svep1 UTSW 4 58128858 missense possibly damaging 0.71
R0634:Svep1 UTSW 4 58070661 missense possibly damaging 0.86
R0636:Svep1 UTSW 4 58073121 nonsense probably null
R0827:Svep1 UTSW 4 58053113 splice site probably benign
R1025:Svep1 UTSW 4 58087817 missense possibly damaging 0.86
R1027:Svep1 UTSW 4 58094084 missense possibly damaging 0.86
R1069:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1161:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1245:Svep1 UTSW 4 58066427 critical splice donor site probably null
R1282:Svep1 UTSW 4 58100032 missense possibly damaging 0.93
R1310:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1444:Svep1 UTSW 4 58115754 missense possibly damaging 0.53
R1460:Svep1 UTSW 4 58068740 missense possibly damaging 0.85
R1500:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1628:Svep1 UTSW 4 58107561 missense probably benign 0.00
R1712:Svep1 UTSW 4 58070629 missense probably benign 0.06
R1774:Svep1 UTSW 4 58146562 missense possibly damaging 0.92
R1783:Svep1 UTSW 4 58073333 missense probably benign
R1829:Svep1 UTSW 4 58096310 missense possibly damaging 0.93
R1978:Svep1 UTSW 4 58097292 missense possibly damaging 0.73
R1993:Svep1 UTSW 4 58064170 critical splice donor site probably null
R2017:Svep1 UTSW 4 58070568 missense probably benign 0.08
R2058:Svep1 UTSW 4 58084554 missense possibly damaging 0.92
R2109:Svep1 UTSW 4 58206030 missense possibly damaging 0.51
R2215:Svep1 UTSW 4 58138602 splice site probably benign
R2281:Svep1 UTSW 4 58082677 missense possibly damaging 0.85
R2504:Svep1 UTSW 4 58135628 splice site probably null
R2763:Svep1 UTSW 4 58084061 missense possibly damaging 0.86
R3122:Svep1 UTSW 4 58087845 missense possibly damaging 0.51
R3605:Svep1 UTSW 4 58066542 missense probably benign 0.32
R3763:Svep1 UTSW 4 58084833 missense possibly damaging 0.89
R3827:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3829:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3830:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3910:Svep1 UTSW 4 58145156 critical splice donor site probably null
R3943:Svep1 UTSW 4 58084807 splice site probably null
R3944:Svep1 UTSW 4 58084807 splice site probably null
R4153:Svep1 UTSW 4 58089426 missense possibly damaging 0.52
R4154:Svep1 UTSW 4 58069068 missense possibly damaging 0.71
R4191:Svep1 UTSW 4 58046601 missense possibly damaging 0.86
R4355:Svep1 UTSW 4 58138695 missense possibly damaging 0.71
R4388:Svep1 UTSW 4 58069249 missense possibly damaging 0.93
R4532:Svep1 UTSW 4 58068886 missense possibly damaging 0.52
R4584:Svep1 UTSW 4 58068526 nonsense probably null
R4592:Svep1 UTSW 4 58084028 missense possibly damaging 0.93
R4593:Svep1 UTSW 4 58091944 missense possibly damaging 0.71
R4625:Svep1 UTSW 4 58072698 missense probably damaging 0.98
R4639:Svep1 UTSW 4 58082724 missense probably benign
R4700:Svep1 UTSW 4 58097323 missense possibly damaging 0.71
R4720:Svep1 UTSW 4 58205869 missense possibly damaging 0.71
R4724:Svep1 UTSW 4 58070752 missense possibly damaging 0.71
R4753:Svep1 UTSW 4 58053212 missense probably benign 0.06
R4781:Svep1 UTSW 4 58070340 missense probably damaging 0.98
R4820:Svep1 UTSW 4 58082664 missense probably benign 0.27
R4896:Svep1 UTSW 4 58087751 missense probably benign 0.08
R4905:Svep1 UTSW 4 58069308 missense probably benign 0.00
R4910:Svep1 UTSW 4 58096276 missense possibly damaging 0.71
R4972:Svep1 UTSW 4 58087778 missense possibly damaging 0.71
R5004:Svep1 UTSW 4 58087751 missense probably benign 0.08
R5088:Svep1 UTSW 4 58120648 missense possibly damaging 0.73
R5112:Svep1 UTSW 4 58068610 nonsense probably null
R5185:Svep1 UTSW 4 58084534 missense probably damaging 0.99
R5302:Svep1 UTSW 4 58096183 missense possibly damaging 0.71
R5307:Svep1 UTSW 4 58072677 missense possibly damaging 0.71
R5339:Svep1 UTSW 4 58121892 missense possibly damaging 0.96
R5379:Svep1 UTSW 4 58072991 missense possibly damaging 0.51
R5384:Svep1 UTSW 4 58104545 missense possibly damaging 0.71
R5414:Svep1 UTSW 4 58206322 missense possibly damaging 0.53
R5514:Svep1 UTSW 4 58044054 missense possibly damaging 0.53
R5538:Svep1 UTSW 4 58049282 critical splice acceptor site probably null
R5549:Svep1 UTSW 4 58057954 missense probably benign 0.32
R5618:Svep1 UTSW 4 58070537 missense probably benign
R5623:Svep1 UTSW 4 58091964 missense possibly damaging 0.92
R5686:Svep1 UTSW 4 58072826 missense possibly damaging 0.71
R5743:Svep1 UTSW 4 58096223 missense possibly damaging 0.71
R5773:Svep1 UTSW 4 58099985 missense possibly damaging 0.86
R5809:Svep1 UTSW 4 58116524 missense possibly damaging 0.73
R5896:Svep1 UTSW 4 58084906 missense possibly damaging 0.71
R5918:Svep1 UTSW 4 58069345 missense possibly damaging 0.71
R5969:Svep1 UTSW 4 58070977 nonsense probably null
R6010:Svep1 UTSW 4 58115832 missense possibly damaging 0.95
R6187:Svep1 UTSW 4 58072872 missense probably damaging 1.00
R6192:Svep1 UTSW 4 58104536 missense possibly damaging 0.92
R6209:Svep1 UTSW 4 58128869 missense probably benign 0.32
R6234:Svep1 UTSW 4 58113458 intron probably null
R6326:Svep1 UTSW 4 58073045 missense possibly damaging 0.51
R6400:Svep1 UTSW 4 58049169 missense probably damaging 1.00
R6418:Svep1 UTSW 4 58053126 missense probably benign 0.01
R6440:Svep1 UTSW 4 58116555 missense possibly damaging 0.53
R6489:Svep1 UTSW 4 58100066 missense probably damaging 1.00
R6515:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R6738:Svep1 UTSW 4 58123180 missense possibly damaging 0.71
R6773:Svep1 UTSW 4 58049146 missense possibly damaging 0.71
R6796:Svep1 UTSW 4 58064275 missense probably benign 0.01
X0063:Svep1 UTSW 4 58070468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTCCCAGCCCCAAATTTCG -3'
(R):5'- GCGTCAATCACAGTGGCATCAAGG -3'

Sequencing Primer
(F):5'- CGCCTCATATTGCTTTGTCAAATAG -3'
(R):5'- GCATCAAGGTCACTTTAGAAGTCAC -3'
Posted On2013-07-24