Incidental Mutation 'R0134:Btbd9'
ID60918
Institutional Source Beutler Lab
Gene Symbol Btbd9
Ensembl Gene ENSMUSG00000062202
Gene NameBTB (POZ) domain containing 9
Synonyms1700023F20Rik
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R0134 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location30215524-30576287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30274942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 492 (D492N)
Ref Sequence ENSEMBL: ENSMUSP00000127300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079924
AA Change: D492N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: D492N

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 283 405 3.9e-11 PFAM
Pfam:F5_F8_type_C 431 554 6.3e-12 PFAM
low complexity region 585 612 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168787
AA Change: D492N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: D492N

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 278 405 1.1e-8 PFAM
Pfam:F5_F8_type_C 433 554 1.4e-8 PFAM
low complexity region 585 612 N/A INTRINSIC
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Btbd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd9 APN 17 30299601 missense possibly damaging 0.71
IGL01651:Btbd9 APN 17 30220417 missense unknown
IGL01814:Btbd9 APN 17 30299535 missense probably benign 0.01
IGL01820:Btbd9 APN 17 30527409 missense possibly damaging 0.82
IGL02014:Btbd9 APN 17 30517150 missense probably damaging 0.98
IGL02075:Btbd9 APN 17 30274936 nonsense probably null
IGL02390:Btbd9 APN 17 30524814 missense probably benign 0.22
IGL02414:Btbd9 APN 17 30220559 missense possibly damaging 0.95
IGL02748:Btbd9 APN 17 30334297 missense possibly damaging 0.81
crumbs UTSW 17 30299736 intron probably null
grain UTSW 17 30274942 missense possibly damaging 0.92
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0122:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0123:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0189:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0190:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0226:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0268:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0344:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0427:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0462:Btbd9 UTSW 17 30530217 missense possibly damaging 0.82
R0645:Btbd9 UTSW 17 30524967 missense probably damaging 0.96
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0974:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R1061:Btbd9 UTSW 17 30527435 missense probably benign 0.00
R1763:Btbd9 UTSW 17 30334297 missense possibly damaging 0.81
R1781:Btbd9 UTSW 17 30513593 missense probably damaging 1.00
R1902:Btbd9 UTSW 17 30530228 missense probably damaging 0.98
R1995:Btbd9 UTSW 17 30274930 missense possibly damaging 0.93
R2224:Btbd9 UTSW 17 30527346 missense probably damaging 0.98
R2237:Btbd9 UTSW 17 30334328 missense probably benign
R3684:Btbd9 UTSW 17 30334307 missense probably damaging 0.99
R3800:Btbd9 UTSW 17 30513659 missense possibly damaging 0.89
R4403:Btbd9 UTSW 17 30485932 intron probably benign
R4492:Btbd9 UTSW 17 30527571 missense probably damaging 0.99
R4654:Btbd9 UTSW 17 30485587 intron probably benign
R4854:Btbd9 UTSW 17 30524865 missense probably damaging 0.98
R5710:Btbd9 UTSW 17 30228868 missense probably benign 0.16
R5963:Btbd9 UTSW 17 30334218 splice site probably null
R6295:Btbd9 UTSW 17 30299736 intron probably null
R6422:Btbd9 UTSW 17 30530256 missense probably benign
R7023:Btbd9 UTSW 17 30527572 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATGGGAATGCGCTTCACCTC -3'
(R):5'- TCTCCACGGCAGGTTATCTTACCAG -3'

Sequencing Primer
(F):5'- GCAGGACACTTTCGTTCTGT -3'
(R):5'- GTACACATTAGCATCCGTTGG -3'
Posted On2013-07-24