Incidental Mutation 'R0139:Ccdc40'
ID60939
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Namecoiled-coil domain containing 40
SynonymsB930008I02Rik
MMRRC Submission 038424-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R0139 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location119228572-119265236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119264299 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1122 (G1122S)
Ref Sequence ENSEMBL: ENSMUSP00000039463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000035935] [ENSMUST00000053440] [ENSMUST00000106258] [ENSMUST00000106259]
Predicted Effect probably benign
Transcript: ENSMUST00000026666
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035935
AA Change: G1122S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: G1122S

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053440
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106258
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106259
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155683
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,214 probably benign Het
2010111I01Rik A G 13: 63,190,484 N558S probably benign Het
A230072I06Rik C T 8: 12,279,899 S118L unknown Het
Adprhl2 A G 4: 126,318,154 Y122H probably damaging Het
Ankrd52 T C 10: 128,386,138 S544P probably benign Het
Arhgef7 A G 8: 11,800,503 E111G probably damaging Het
Atp11a A G 8: 12,846,054 M755V probably benign Het
Atp2a2 A G 5: 122,491,715 I97T probably damaging Het
Bmp3 G A 5: 98,879,909 D463N possibly damaging Het
Cacna2d4 T C 6: 119,278,269 probably benign Het
Ccdc28a G A 10: 18,230,440 S46F possibly damaging Het
Ccdc36 T C 9: 108,412,496 T176A probably damaging Het
Cenpw T G 10: 30,200,459 T8P probably benign Het
Cfap44 G C 16: 44,433,422 G893R possibly damaging Het
Cops7a A T 6: 124,961,360 C110S probably damaging Het
Cstl1 A G 2: 148,755,325 N134S probably damaging Het
Cyp2s1 G T 7: 25,811,689 probably null Het
Dio2 T A 12: 90,729,843 N124Y probably damaging Het
Ecel1 C A 1: 87,154,526 G155V possibly damaging Het
Efr3a G T 15: 65,845,981 V337F possibly damaging Het
Eva1b A C 4: 126,149,653 H162P probably damaging Het
Exoc5 C T 14: 49,036,036 E301K probably damaging Het
F13b G A 1: 139,508,203 S249N probably damaging Het
Fam120b C T 17: 15,426,184 probably benign Het
Gbf1 T C 19: 46,261,792 L396S probably damaging Het
Gck T A 11: 5,909,139 K143* probably null Het
Gck C A 11: 5,910,370 V91L probably damaging Het
Glt8d2 T C 10: 82,660,810 N138S probably damaging Het
Gm17359 A T 3: 79,405,835 Y72F probably damaging Het
Gm4884 T C 7: 41,042,963 F119L probably benign Het
Igsf11 T C 16: 39,008,878 S45P probably damaging Het
Il10 G A 1: 131,022,534 V142M probably damaging Het
Insc A T 7: 114,769,002 H9L probably damaging Het
Iqsec1 G T 6: 90,809,758 probably benign Het
Katnb1 A G 8: 95,098,422 S611G possibly damaging Het
Kcnb1 A G 2: 167,105,539 I463T possibly damaging Het
Lao1 A G 4: 118,964,202 N90S probably benign Het
Med16 T A 10: 79,896,801 M710L probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mtus1 G A 8: 41,016,196 probably benign Het
Mybpc3 A G 2: 91,120,337 probably benign Het
Ndor1 C T 2: 25,248,354 V405M possibly damaging Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nme8 T C 13: 19,677,848 I204V probably benign Het
Nup133 A T 8: 123,929,343 N466K probably benign Het
Nxt1 A G 2: 148,675,470 T44A probably benign Het
Olfr1303 A T 2: 111,814,354 I124K possibly damaging Het
Olfr1382 C T 11: 49,535,574 L130F probably benign Het
Olfr1508 T C 14: 52,463,212 T239A probably damaging Het
Olfr310 T C 7: 86,268,979 E270G probably benign Het
Olfr697 A T 7: 106,741,625 I103N probably benign Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Pced1a T C 2: 130,421,907 K275R probably benign Het
Pdcd11 A G 19: 47,110,959 probably null Het
Phldb2 A C 16: 45,770,666 probably benign Het
Pifo A T 3: 105,999,570 M171K possibly damaging Het
Piwil1 C A 5: 128,747,323 S490Y probably damaging Het
Plekhh3 T C 11: 101,163,675 probably benign Het
Ppargc1b A T 18: 61,315,963 probably benign Het
Psg19 C T 7: 18,797,017 V71I possibly damaging Het
Ptk6 T C 2: 181,196,931 probably benign Het
Pus7 A G 5: 23,778,092 S126P probably damaging Het
Rab6b T A 9: 103,140,377 probably null Het
Ranbp3 G A 17: 56,709,272 R347Q possibly damaging Het
Sbf1 A T 15: 89,302,498 L866Q probably damaging Het
Slc25a34 A G 4: 141,622,352 V164A possibly damaging Het
Smg1 A G 7: 118,152,675 probably null Het
Spin1 G T 13: 51,149,012 V214L probably benign Het
Sptbn1 T C 11: 30,142,289 N492S probably benign Het
Stk-ps2 A G 1: 46,029,795 noncoding transcript Het
Taar7f T C 10: 24,050,414 I302T probably benign Het
Tdrd1 C A 19: 56,843,198 H340Q probably benign Het
Thumpd3 A G 6: 113,067,801 D498G probably benign Het
Tpgs2 A G 18: 25,149,185 L103P probably damaging Het
Trip10 A G 17: 57,261,633 probably null Het
Trip6 A T 5: 137,312,174 H269Q probably benign Het
Trmt12 T C 15: 58,872,894 V47A possibly damaging Het
Trpm7 A T 2: 126,812,771 S1416T probably benign Het
Tsks G A 7: 44,954,459 A438T probably benign Het
Ttn T C 2: 76,897,286 probably benign Het
Twf2 G A 9: 106,212,956 V136M possibly damaging Het
Uty A C Y: 1,197,223 Y115D probably damaging Het
Vcan A G 13: 89,691,261 S2055P probably damaging Het
Yes1 A G 5: 32,684,695 Q521R possibly damaging Het
Zfp114 A T 7: 24,181,260 T344S possibly damaging Het
Zfp661 A T 2: 127,578,612 V89D possibly damaging Het
Zfp91 A T 19: 12,770,470 Y430N probably damaging Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119242719 missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119243085 missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119231971 unclassified probably null
IGL02640:Ccdc40 APN 11 119238078 missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119242510 missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119263201 missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119242451 missense probably damaging 1.00
R0140:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119242804 missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119231803 missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119263189 missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119259904 missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119263075 unclassified probably null
R2106:Ccdc40 UTSW 11 119264297 missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119263117 missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119234779 missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119264281 missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119242509 missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119231532 missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119231506 missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119253621 missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119231788 missense probably benign
R5237:Ccdc40 UTSW 11 119259976 missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119237927 missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119231572 missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119246080 critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119242746 missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119253403 missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119251012 missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119231978 missense probably benign
R6166:Ccdc40 UTSW 11 119232001 missense probably benign
R6336:Ccdc40 UTSW 11 119231993 missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119242734 missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119242739 missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119231786 missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119264444 missense probably damaging 0.99
S24628:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGCAAACCTGAATGAATCCCAGTG -3'
(R):5'- TGATGTGACCGTAGGACTGCCAAC -3'

Sequencing Primer
(F):5'- CCTGAATGAATCCCAGTGTCTGAG -3'
(R):5'- TCAGAACATGTGGTGACTCC -3'
Posted On2013-07-24