Incidental Mutation 'R0684:Wdr12'
ID61061
Institutional Source Beutler Lab
Gene Symbol Wdr12
Ensembl Gene ENSMUSG00000026019
Gene NameWD repeat domain 12
SynonymsYtm1p, 4933402C23Rik, Ytm1
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0684 (G1)
Quality Score94
Status Validated
Chromosome1
Chromosomal Location60069785-60098645 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 60089366 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027173] [ENSMUST00000117438] [ENSMUST00000122038] [ENSMUST00000141417] [ENSMUST00000143342]
Predicted Effect probably benign
Transcript: ENSMUST00000027173
SMART Domains Protein: ENSMUSP00000027173
Gene: ENSMUSG00000026019

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117438
SMART Domains Protein: ENSMUSP00000113494
Gene: ENSMUSG00000026019

DomainStartEndE-ValueType
Pfam:NLE 4 70 2e-19 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122038
SMART Domains Protein: ENSMUSP00000113148
Gene: ENSMUSG00000026019

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136461
Predicted Effect probably benign
Transcript: ENSMUST00000141417
SMART Domains Protein: ENSMUSP00000117747
Gene: ENSMUSG00000026019

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143342
SMART Domains Protein: ENSMUSP00000117391
Gene: ENSMUSG00000026019

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147413
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein is highly similar to the mouse WD repeat domain 12 protein at the amino acid level. The protein encoded by this gene is a component of a nucleolar protein complex that affects maturation of the large ribosomal subunit.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Wdr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Wdr12 APN 1 60080559 missense probably damaging 1.00
R0313:Wdr12 UTSW 1 60082579 missense possibly damaging 0.92
R1157:Wdr12 UTSW 1 60078230 missense probably damaging 1.00
R1411:Wdr12 UTSW 1 60088072 missense probably benign 0.01
R1539:Wdr12 UTSW 1 60083848 splice site probably null
R2075:Wdr12 UTSW 1 60091063 missense possibly damaging 0.77
R3113:Wdr12 UTSW 1 60087062 missense probably benign 0.01
R4533:Wdr12 UTSW 1 60078195 missense probably benign 0.05
R5153:Wdr12 UTSW 1 60094511 missense probably benign 0.08
R5196:Wdr12 UTSW 1 60087084 missense probably damaging 1.00
R6603:Wdr12 UTSW 1 60082624 missense probably damaging 1.00
R7310:Wdr12 UTSW 1 60082575 nonsense probably null
R7466:Wdr12 UTSW 1 60094511 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- cacacacacacacTTCACAAAGCAAA -3'
(R):5'- GTGTCAAGACAggccattctgtaact -3'

Sequencing Primer
(F):5'- CTGCAACTTCATGGTAGCAGG -3'
(R):5'- gccattctgtaacttgcactg -3'
Posted On2013-07-30