Incidental Mutation 'R0684:Thnsl1'
ID61063
Institutional Source Beutler Lab
Gene Symbol Thnsl1
Ensembl Gene ENSMUSG00000048550
Gene Namethreonine synthase-like 1 (bacterial)
Synonyms
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0684 (G1)
Quality Score118
Status Validated
Chromosome2
Chromosomal Location21205724-21215009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21211666 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000052452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054591] [ENSMUST00000102951] [ENSMUST00000102952] [ENSMUST00000138914] [ENSMUST00000138965]
Predicted Effect probably benign
Transcript: ENSMUST00000054591
AA Change: D77G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052452
Gene: ENSMUSG00000048550
AA Change: D77G

DomainStartEndE-ValueType
Pfam:AAA_17 57 202 2e-8 PFAM
Pfam:SKI 64 221 5.8e-40 PFAM
Pfam:Thr_synth_N 230 318 3.2e-16 PFAM
Pfam:PALP 326 659 2.2e-9 PFAM
low complexity region 684 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102951
SMART Domains Protein: ENSMUSP00000100016
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102952
SMART Domains Protein: ENSMUSP00000100017
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138914
Predicted Effect probably benign
Transcript: ENSMUST00000138965
SMART Domains Protein: ENSMUSP00000115186
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 93 5e-16 PDB
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Thnsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Thnsl1 APN 2 21212449 missense possibly damaging 0.47
IGL00756:Thnsl1 APN 2 21212612 missense probably benign 0.02
IGL00952:Thnsl1 APN 2 21211956 missense possibly damaging 0.89
IGL01020:Thnsl1 APN 2 21212494 missense probably damaging 0.99
IGL01350:Thnsl1 APN 2 21212200 missense probably benign 0.30
IGL01476:Thnsl1 APN 2 21212159 missense probably benign 0.00
IGL01548:Thnsl1 APN 2 21213132 missense probably damaging 1.00
IGL01916:Thnsl1 APN 2 21212665 missense possibly damaging 0.66
IGL02176:Thnsl1 APN 2 21211854 missense possibly damaging 0.69
IGL03001:Thnsl1 APN 2 21211644 missense probably damaging 0.99
IGL03219:Thnsl1 APN 2 21212406 missense probably benign 0.14
IGL03386:Thnsl1 APN 2 21211548 missense probably benign 0.01
R0738:Thnsl1 UTSW 2 21213362 missense probably damaging 1.00
R1119:Thnsl1 UTSW 2 21213046 missense probably damaging 1.00
R1121:Thnsl1 UTSW 2 21212164 missense probably benign 0.00
R2150:Thnsl1 UTSW 2 21212533 missense probably benign 0.08
R3545:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R3547:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R4244:Thnsl1 UTSW 2 21212248 missense probably benign
R4245:Thnsl1 UTSW 2 21212248 missense probably benign
R4510:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4511:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4678:Thnsl1 UTSW 2 21211541 splice site probably null
R4753:Thnsl1 UTSW 2 21213364 missense probably damaging 1.00
R4795:Thnsl1 UTSW 2 21212045 nonsense probably null
R4796:Thnsl1 UTSW 2 21212045 nonsense probably null
R5584:Thnsl1 UTSW 2 21213412 missense probably damaging 1.00
R5586:Thnsl1 UTSW 2 21212390 nonsense probably null
R5682:Thnsl1 UTSW 2 21212068 missense possibly damaging 0.69
R5718:Thnsl1 UTSW 2 21212000 missense possibly damaging 0.54
R6159:Thnsl1 UTSW 2 21212205 nonsense probably null
R6795:Thnsl1 UTSW 2 21213492 nonsense probably null
R7084:Thnsl1 UTSW 2 21212330 missense possibly damaging 0.69
R7153:Thnsl1 UTSW 2 21212953 missense possibly damaging 0.64
R7243:Thnsl1 UTSW 2 21212847 missense probably damaging 1.00
R7265:Thnsl1 UTSW 2 21212458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGACCTTGACCAGATGTCACC -3'
(R):5'- TGGACCCACTGAGGGAAATCACAC -3'

Sequencing Primer
(F):5'- CAGATAGCACAGGAGTGTCTTTC -3'
(R):5'- TGAGGGAAATCACACTTCCAG -3'
Posted On2013-07-30