Incidental Mutation 'R0684:Zfp94'
ID61069
Institutional Source Beutler Lab
Gene Symbol Zfp94
Ensembl Gene ENSMUSG00000074282
Gene Namezinc finger protein 94
Synonyms
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0684 (G1)
Quality Score148
Status Validated
Chromosome7
Chromosomal Location24301704-24316666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24303070 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 316 (S316T)
Ref Sequence ENSEMBL: ENSMUSP00000104075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032673] [ENSMUST00000077780] [ENSMUST00000108436] [ENSMUST00000145131]
Predicted Effect probably damaging
Transcript: ENSMUST00000032673
AA Change: S310T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032673
Gene: ENSMUSG00000074282
AA Change: S310T

DomainStartEndE-ValueType
KRAB 2 59 3.06e-19 SMART
ZnF_C2H2 157 179 5.06e-2 SMART
ZnF_C2H2 185 207 8.47e-4 SMART
ZnF_C2H2 213 235 4.72e-2 SMART
ZnF_C2H2 241 263 1.28e-3 SMART
ZnF_C2H2 269 291 5.21e-4 SMART
ZnF_C2H2 297 319 9.08e-4 SMART
ZnF_C2H2 325 347 2.09e-3 SMART
ZnF_C2H2 353 375 8.94e-3 SMART
ZnF_C2H2 381 403 2.4e-3 SMART
ZnF_C2H2 409 431 8.6e-5 SMART
ZnF_C2H2 437 459 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077780
SMART Domains Protein: ENSMUSP00000076954
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 63 2.28e-27 SMART
ZnF_C2H2 311 333 1.4e-4 SMART
ZnF_C2H2 339 361 5.5e-3 SMART
ZnF_C2H2 367 389 2.99e-4 SMART
ZnF_C2H2 395 417 1.18e-2 SMART
ZnF_C2H2 423 445 2.4e-3 SMART
ZnF_C2H2 451 473 2.95e-3 SMART
ZnF_C2H2 479 501 9.88e-5 SMART
ZnF_C2H2 507 529 1.5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108436
AA Change: S316T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104075
Gene: ENSMUSG00000074282
AA Change: S316T

DomainStartEndE-ValueType
KRAB 8 65 3.06e-19 SMART
ZnF_C2H2 163 185 5.06e-2 SMART
ZnF_C2H2 191 213 8.47e-4 SMART
ZnF_C2H2 219 241 4.72e-2 SMART
ZnF_C2H2 247 269 1.28e-3 SMART
ZnF_C2H2 275 297 5.21e-4 SMART
ZnF_C2H2 303 325 9.08e-4 SMART
ZnF_C2H2 331 353 2.09e-3 SMART
ZnF_C2H2 359 381 8.94e-3 SMART
ZnF_C2H2 387 409 2.4e-3 SMART
ZnF_C2H2 415 437 8.6e-5 SMART
ZnF_C2H2 443 465 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139811
Predicted Effect probably benign
Transcript: ENSMUST00000145131
SMART Domains Protein: ENSMUSP00000117077
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 64 4.63e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206535
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Zfp94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Zfp94 APN 7 24311481 utr 5 prime probably benign
IGL02645:Zfp94 APN 7 24303754 missense probably benign
R1177:Zfp94 UTSW 7 24303528 missense probably damaging 1.00
R1644:Zfp94 UTSW 7 24311502 splice site probably benign
R1675:Zfp94 UTSW 7 24302834 missense probably damaging 1.00
R1826:Zfp94 UTSW 7 24309115 missense probably damaging 1.00
R1861:Zfp94 UTSW 7 24309116 missense probably damaging 1.00
R3932:Zfp94 UTSW 7 24303687 missense probably benign 0.06
R4912:Zfp94 UTSW 7 24303741 missense probably benign 0.05
R5663:Zfp94 UTSW 7 24302827 missense probably damaging 1.00
R6539:Zfp94 UTSW 7 24303291 missense probably damaging 1.00
R7023:Zfp94 UTSW 7 24303396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCACTCCTCACATTGATAGGGTC -3'
(R):5'- TGCCATGCTTGCTGGAAGAGTTTC -3'

Sequencing Primer
(F):5'- GATAGGGTCTCTCTCCCGTG -3'
(R):5'- gcgaggagtgtgggaaag -3'
Posted On2013-07-30