Incidental Mutation 'R0684:Hps5'
ID61071
Institutional Source Beutler Lab
Gene Symbol Hps5
Ensembl Gene ENSMUSG00000014418
Gene NameHPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonymsru-2, ru2, ruby eye 2
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0684 (G1)
Quality Score110
Status Validated
Chromosome7
Chromosomal Location46760466-46796064 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 46783469 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014562] [ENSMUST00000107653] [ENSMUST00000107653] [ENSMUST00000107654] [ENSMUST00000107654] [ENSMUST00000123725] [ENSMUST00000142663] [ENSMUST00000152759] [ENSMUST00000211347]
Predicted Effect probably null
Transcript: ENSMUST00000014562
SMART Domains Protein: ENSMUSP00000014562
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107653
SMART Domains Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 6e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 396 416 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 956 965 N/A INTRINSIC
low complexity region 988 1000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107653
SMART Domains Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 6e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 396 416 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 956 965 N/A INTRINSIC
low complexity region 988 1000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107654
SMART Domains Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107654
SMART Domains Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123725
SMART Domains Protein: ENSMUSP00000116770
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1tbga_ 24 107 5e-4 SMART
Blast:WD40 63 103 1e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142663
SMART Domains Protein: ENSMUSP00000122887
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 8e-8 SMART
Blast:WD40 63 103 9e-20 BLAST
Blast:WD40 111 151 2e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145776
Predicted Effect probably benign
Transcript: ENSMUST00000152759
SMART Domains Protein: ENSMUSP00000115786
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 2e-8 SMART
Blast:WD40 63 103 1e-21 BLAST
Blast:WD40 111 151 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000211347
Predicted Effect probably benign
Transcript: ENSMUST00000211471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211528
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Hps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hps5 APN 7 46775938 missense probably damaging 1.00
IGL00543:Hps5 APN 7 46778073 missense probably benign 0.37
IGL01090:Hps5 APN 7 46788327 missense probably benign 0.02
IGL01351:Hps5 APN 7 46761432 missense probably damaging 1.00
IGL01479:Hps5 APN 7 46762942 critical splice donor site probably null
IGL02056:Hps5 APN 7 46788182 missense probably damaging 1.00
IGL02117:Hps5 APN 7 46783516 missense probably damaging 1.00
IGL02210:Hps5 APN 7 46786570 missense probably benign 0.03
IGL02967:Hps5 APN 7 46769380 missense possibly damaging 0.69
IGL03046:Hps5 APN 7 46777039 splice site probably benign
IGL03187:Hps5 APN 7 46773207 missense probably damaging 1.00
IGL03259:Hps5 APN 7 46763102 missense probably damaging 0.99
dorian_gray UTSW 7 46784145 unclassified probably benign
smoky UTSW 7 46769351 nonsense probably null
Titan UTSW 7 46783469 critical splice donor site probably null
toffee UTSW 7 46777075 intron probably benign
wombat UTSW 7 46783634 missense probably damaging 1.00
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0141:Hps5 UTSW 7 46789181 missense probably damaging 1.00
R0383:Hps5 UTSW 7 46769288 splice site probably null
R0402:Hps5 UTSW 7 46790909 splice site probably benign
R1159:Hps5 UTSW 7 46772554 unclassified probably null
R1938:Hps5 UTSW 7 46773267 missense probably damaging 1.00
R2058:Hps5 UTSW 7 46768051 missense probably damaging 1.00
R3613:Hps5 UTSW 7 46776874 critical splice donor site probably null
R3881:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3882:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3914:Hps5 UTSW 7 46783526 missense probably damaging 1.00
R4095:Hps5 UTSW 7 46775794 missense probably benign 0.01
R4457:Hps5 UTSW 7 46783613 missense probably benign 0.00
R4739:Hps5 UTSW 7 46786589 missense probably benign
R4838:Hps5 UTSW 7 46788354 missense probably damaging 1.00
R4934:Hps5 UTSW 7 46769351 nonsense probably null
R5876:Hps5 UTSW 7 46789196 missense probably damaging 1.00
R6056:Hps5 UTSW 7 46767097 missense probably benign 0.00
R6129:Hps5 UTSW 7 46771774 missense probably benign
R6878:Hps5 UTSW 7 46783634 missense probably damaging 1.00
X0021:Hps5 UTSW 7 46763093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAGATGCAAGAGTTTGGGGAATGC -3'
(R):5'- ACAGGGTAACCATCCGTGCCATTG -3'

Sequencing Primer
(F):5'- TCATACTGAGGCTCTGATCTAGAAGG -3'
(R):5'- GTAGGTAAACCACCTTTGTCTTTG -3'
Posted On2013-07-30