Incidental Mutation 'R0684:Ptprk'
ID61078
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0684 (G1)
Quality Score157
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 28483298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably benign
Transcript: ENSMUST00000166468
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218276
Predicted Effect probably benign
Transcript: ENSMUST00000218359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCCCTTCCTTGCTGGGTTAAAG -3'
(R):5'- GGGACAGAAACACCCTTGGAAGTC -3'

Sequencing Primer
(F):5'- TGAATATGAGTGCAAGTCCCC -3'
(R):5'- TGGAAGTCCCCTCTTAACTACAGG -3'
Posted On2013-07-30