Incidental Mutation 'R0684:Olfr136'
ID61092
Institutional Source Beutler Lab
Gene Symbol Olfr136
Ensembl Gene ENSMUSG00000096840
Gene Nameolfactory receptor 136
SynonymsGA_x6K02T2PSCP-2779375-2780313, MOR256-7
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0684 (G1)
Quality Score219
Status Validated
Chromosome17
Chromosomal Location38329831-38336643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38335844 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 229 (K229R)
Ref Sequence ENSEMBL: ENSMUSP00000149856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]
Predicted Effect probably benign
Transcript: ENSMUST00000077203
AA Change: K229R

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: K229R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-48 PFAM
Pfam:7tm_1 41 290 7.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208525
AA Change: K229R

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000208539
AA Change: K229R

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214035
AA Change: K229R

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216963
AA Change: K229R

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Olfr136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Olfr136 APN 17 38335957 missense probably benign 0.00
IGL01787:Olfr136 APN 17 38335579 missense probably damaging 0.98
IGL02480:Olfr136 APN 17 38335423 missense probably benign 0.32
IGL02603:Olfr136 APN 17 38335513 missense probably damaging 1.00
IGL03122:Olfr136 APN 17 38335301 missense probably benign 0.01
R0295:Olfr136 UTSW 17 38335291 missense probably damaging 1.00
R1874:Olfr136 UTSW 17 38335969 missense probably damaging 1.00
R3436:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R3437:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R4714:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4715:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4716:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4878:Olfr136 UTSW 17 38335627 missense probably benign
R5296:Olfr136 UTSW 17 38335456 nonsense probably null
R5370:Olfr136 UTSW 17 38335444 nonsense probably null
R5413:Olfr136 UTSW 17 38335624 missense probably benign 0.03
R5988:Olfr136 UTSW 17 38336020 missense probably damaging 1.00
R6156:Olfr136 UTSW 17 38335173 missense probably damaging 0.99
R6550:Olfr136 UTSW 17 38336005 missense possibly damaging 0.65
R7395:Olfr136 UTSW 17 38335864 nonsense probably null
V5088:Olfr136 UTSW 17 38335159 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- CGATATGTGGCTATCTGCAAACCTCTC -3'
(R):5'- GCAAGAATGCTATACTCTGTGGACCTG -3'

Sequencing Primer
(F):5'- CCATTGTGTGGCATACATAAACTGG -3'
(R):5'- CAGGAGTTTTTTTAAGGCACCC -3'
Posted On2013-07-30