Incidental Mutation 'R0685:Psme4'
ID61133
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 038870-MU
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0685 (G1)
Quality Score142
Status Validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30878415 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1812 (T1812A)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: T1812A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: T1812A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155719
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bcr T C 10: 75,131,643 W570R probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Chl1 G A 6: 103,708,542 probably null Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Hectd2 T A 19: 36,569,431 V64D probably damaging Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Papss1 A C 3: 131,583,093 N119H possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Pole2 C A 12: 69,211,413 A239S probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Sema6c T C 3: 95,172,710 C772R possibly damaging Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 intron probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 intron probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 intron probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CGCAAAACAGGTCACCTTCGTAGATG -3'
(R):5'- CAGCACTGGAAATCGAATTAGGGTCTC -3'

Sequencing Primer
(F):5'- atatTGAACTGGTCTAGCAATGTGAC -3'
(R):5'- ctcttcctctaaactatctacccc -3'
Posted On2013-07-30