Incidental Mutation 'R0685:Pole2'
ID61137
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Namepolymerase (DNA directed), epsilon 2 (p59 subunit)
SynonymsDNA polymerase epsilon small subunit
MMRRC Submission 038870-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0685 (G1)
Quality Score102
Status Validated
Chromosome12
Chromosomal Location69201773-69228195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69211413 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 239 (A239S)
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411]
Predicted Effect probably damaging
Transcript: ENSMUST00000021359
AA Change: A239S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: A239S

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221411
AA Change: A239S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221806
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bcr T C 10: 75,131,643 W570R probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Chl1 G A 6: 103,708,542 probably null Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Hectd2 T A 19: 36,569,431 V64D probably damaging Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Papss1 A C 3: 131,583,093 N119H possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Psme4 A G 11: 30,878,415 T1812A probably damaging Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Sema6c T C 3: 95,172,710 C772R possibly damaging Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69226445 splice site probably benign
IGL00940:Pole2 APN 12 69215360 missense probably damaging 1.00
IGL01593:Pole2 APN 12 69223099 splice site probably null
IGL01609:Pole2 APN 12 69207857 critical splice donor site probably null
IGL01717:Pole2 APN 12 69213849 missense probably damaging 1.00
IGL02168:Pole2 APN 12 69201886 unclassified probably benign
IGL02208:Pole2 APN 12 69223162 missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69209875 missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69209985 nonsense probably null
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0396:Pole2 UTSW 12 69222386 splice site probably benign
R0574:Pole2 UTSW 12 69211457 splice site probably benign
R0620:Pole2 UTSW 12 69209879 missense probably damaging 1.00
R0791:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1452:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1453:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1455:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1912:Pole2 UTSW 12 69209990 missense probably damaging 0.99
R2067:Pole2 UTSW 12 69228152 missense probably benign 0.01
R2929:Pole2 UTSW 12 69209938 missense probably benign 0.13
R3016:Pole2 UTSW 12 69222062 missense probably benign 0.14
R4504:Pole2 UTSW 12 69222468 missense probably benign 0.00
R4765:Pole2 UTSW 12 69222052 missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69226365 missense probably benign 0.00
R4896:Pole2 UTSW 12 69223150 missense probably damaging 0.97
R6998:Pole2 UTSW 12 69213906 missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69202910 missense probably damaging 1.00
R7535:Pole2 UTSW 12 69222429 missense not run
Predicted Primers PCR Primer
(F):5'- AGTGTTTCACAGTGTGCCGCAG -3'
(R):5'- GCTCTTCAGCAAGTGCTATAACCCC -3'

Sequencing Primer
(F):5'- GCGCTGCACATTTACAGAG -3'
(R):5'- AAATATGCACTGTCCGTGGC -3'
Posted On2013-07-30