Incidental Mutation 'R0686:1700123K08Rik'
List |< first << previous [record 88 of 33389] next >> last >|
ID61161
Institutional Source Beutler Lab
Gene Symbol 1700123K08Rik
Ensembl Gene ENSMUSG00000029526
Gene NameRIKEN cDNA 1700123K08 gene
Synonyms
MMRRC Submission 038871-MU
Accession Numbers

NCBI RefSeq: NM_029693.2; MGI:1923908

Is this an essential gene? Probably non essential (E-score: 0.020) question?
Stock #R0686 (G1)
Quality Score224
Status Not validated
Chromosome5
Chromosomal Location138561840-138564712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138564537 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 42 (E42K)
Ref Sequence ENSEMBL: ENSMUSP00000031501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031501
AA Change: E42K

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031501
Gene: ENSMUSG00000029526
AA Change: E42K

DomainStartEndE-ValueType
SCOP:d1bkds_ 48 165 6e-22 SMART
Blast:RasGEFN 66 182 2e-57 BLAST
low complexity region 263 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199968
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in 1700123K08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:1700123K08Rik APN 5 138562489 missense probably benign 0.01
IGL02318:1700123K08Rik APN 5 138563576 missense probably damaging 1.00
IGL02451:1700123K08Rik APN 5 138563547 missense probably damaging 1.00
IGL03263:1700123K08Rik APN 5 138564237 missense probably damaging 0.98
P0016:1700123K08Rik UTSW 5 138562938 nonsense probably null
R2051:1700123K08Rik UTSW 5 138564185 missense probably damaging 1.00
R2055:1700123K08Rik UTSW 5 138562845 missense probably damaging 0.99
R2185:1700123K08Rik UTSW 5 138563567 missense probably damaging 1.00
R2761:1700123K08Rik UTSW 5 138564174 missense possibly damaging 0.72
R4233:1700123K08Rik UTSW 5 138564192 missense probably damaging 1.00
R5610:1700123K08Rik UTSW 5 138564141 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTATGTTGGATGCAGCCACTCAC -3'
(R):5'- ACCTGACTTACTTGTCTGGAGGACC -3'

Sequencing Primer
(F):5'- TCACGGTTCTGAATAGCAGC -3'
(R):5'- GACTTACTTGTCTGGAGGACCTAAAG -3'
Posted On2013-07-30