Incidental Mutation 'R0686:1700074P13Rik'
List |< first << previous [record 88 of 32981] next >> last >|
ID61163
Institutional Source Beutler Lab
Gene Symbol 1700074P13Rik
Ensembl Gene ENSMUSG00000029883
Gene NameRIKEN cDNA 1700074P13 gene
Synonyms
MMRRC Submission 038871-MU
Accession Numbers

Ncbi RefSeq: NM_028550.3; MGI: 1920731

Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R0686 (G1)
Quality Score115
Status Not validated
Chromosome6
Chromosomal Location40920437-40940557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40928518 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 68 (S68F)
Ref Sequence ENSEMBL: ENSMUSP00000112987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031935] [ENSMUST00000122181] [ENSMUST00000136499]
Predicted Effect probably damaging
Transcript: ENSMUST00000031935
AA Change: S68F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031935
Gene: ENSMUSG00000029883
AA Change: S68F

DomainStartEndE-ValueType
Tryp_SPc 24 244 4.27e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122181
AA Change: S68F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112987
Gene: ENSMUSG00000029883
AA Change: S68F

DomainStartEndE-ValueType
Tryp_SPc 24 244 4.27e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136499
AA Change: S68F

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116538
Gene: ENSMUSG00000029883
AA Change: S68F

DomainStartEndE-ValueType
Tryp_SPc 24 174 6.08e-5 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in 1700074P13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03151:1700074P13Rik APN 6 40926012 missense probably damaging 1.00
R0041:1700074P13Rik UTSW 6 40926108 nonsense probably null
R0041:1700074P13Rik UTSW 6 40926108 nonsense probably null
R0799:1700074P13Rik UTSW 6 40928599 missense probably damaging 0.97
R1250:1700074P13Rik UTSW 6 40925975 critical splice donor site probably null
R1499:1700074P13Rik UTSW 6 40921718 missense probably benign 0.26
R1678:1700074P13Rik UTSW 6 40929519 start gained probably benign
R1755:1700074P13Rik UTSW 6 40926162 missense probably damaging 0.99
R1891:1700074P13Rik UTSW 6 40926033 missense possibly damaging 0.73
R3160:1700074P13Rik UTSW 6 40926069 missense probably benign 0.05
R3162:1700074P13Rik UTSW 6 40926069 missense probably benign 0.05
R4194:1700074P13Rik UTSW 6 40921071 missense probably damaging 1.00
R4750:1700074P13Rik UTSW 6 40921021 missense probably damaging 1.00
R6197:1700074P13Rik UTSW 6 40921005 missense probably benign 0.05
R6217:1700074P13Rik UTSW 6 40926085 missense possibly damaging 0.88
R6394:1700074P13Rik UTSW 6 40921792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTAAGAGACTACTCAGCCTTGTTCCC -3'
(R):5'- GTAGCTAATACTCCCAAAGCCGTTCTG -3'

Sequencing Primer
(F):5'- acatcccacaccttgctc -3'
(R):5'- CAAAGCCGTTCTGAAAGAATATAAC -3'
Posted On2013-07-30